BBa_K1884000 1 Paro Paromomycin 2016-10-06T11:00:00Z 2016-10-13T08:31:36Z (1) Kennedy, M., et al. (2010): Rapid blue-light mediated induction of protein interactions in living cells. Nature America. (2) Bugaj, L., et al. (2012): Optogenetic protein clustering and signaling activation in mammalian cells. Nature America. CRY2 is a blue-light stimulated photoreceptor that mediates light responses in plants and animals. The photoactivation of cryptochromes involves the blue-light-dependent photoreduction of flavin adenine dinucleotide via the electron transport chain composed of three evolutionarily conserved tryptophan residues known as the "trp triad." When exposed to blue light, CRY2 would interact with CIB1（cryptochrome-interacting basic-helix-loop-helix 1）. The CRY2/CIB1 interaction is entirely genetically encoded and does not require addition of any exogenous cofactors. The binding naturally reverses within minutes in the dark, allowing rapid shutoff of transcription by placing samples in the dark. true false _2349_ 29275 30234 9 Not in stock false To regulate DNA transcription by blue light, the system is based on a two-hybrid interaction in which a light-mediated protein interaction brings together two halves (a binding domain and an activation domain) of a split transcription factor. If we remove the stimulation of blue light, dark reversion of CRY2 will dissociate the interaction with CIB1 and halt Gal4-dependent transcription false Chengrong Xie annotation2489051 1 Paro range2489051 1 1 819 BBa_K1884000_sequence 1 atggacgatgcgttgcgtgcactgcggggtcggtatcccggttgtgagtgggttgttgtggaggatggggcctcgggggctggtgtttatcggcttcggggtggtgggcgggagttgtttgtcaaggtggcagctctgggggccggggtgggcttgttgggtgaggctgagcggctggtgtggttggcggaggtggggattcccgtacctcgtgttgtggagggtggtggggacgagagggtcgcctggttggtcaccgaagcggttccggggcgtccggccagtgcgcggtggccgcgggagcagcggctggacgtggcggtggcgctcgcggggctcgctcgttcgctgcacgcgctggactgggagcggtgtccgttcgatcgcagtctcgcggtgacggtgccgcaggcggcccgtgctgtcgctgaagggagcgtcgacttggaggatctggacgaggagcggaaggggtggtcgggggagcggcttctcgccgagctggagcggactcggcctgcggacgaggatctggcggtttgccacggtgacctgtgcccggacaacgtgctgctcgaccctcgtacctgcgaggtgaccgggctgatcgacgtggggcgggtcggccgtgcggaccggcactccgatctcgcgctggtgctgcgcgagctggcccacgaggaggacccgtggttcgggccggagtgttccgcggcgttcctgcgggagtacgggcgcgggtgggatggggcggtatcggaggaaaagctggcgttttaccggctgttggacgagttcttctgagggacctgatggtgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z