BBa_K1884004 1 Gal4-UAS Upstream activating sequence 2016-10-06T11:00:00Z 2016-10-15T07:42:46Z PhyB (photochrome B) PhyB is red/far-red photoreceptor involved in the regulation of de-etiolation. It is involved in the light-promotion of seed germination and in the shade avoidance response. false false _2349_ 29275 30234 9 No part sequence false PhyB functions as a transcriptional activator, and can be functionally and mechanistically separated from its role in repression of PIF3 mediated processes. false Chengrong Xie annotation2489054 1 UAS range2489054 1 1 179 BBa_K1884004_sequence 1 cggagtactgtcctccgagcggagtactgtcctccgactcgagcggagtactgtcctccgatcggagtactgtcctccgcgaatcccggagtactgtcctccgaagacgctagcggggggctataaaagggggtgggggcgttcgtcctcactctattagtattttaaatacctagata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z