BBa_K1884006 1 BBa_K1884006 Ferredoxin-NADP(+)Reductase(FNR) 2016-10-08T11:00:00Z 2016-10-17T07:43:45Z The DNA sequence of FNR is designed by ourselves Under anaerobic conditions, fumarate or nitrate, among others, can replace O2 as the terminal electron acceptor. Optimal switching from one respiratory pathway to another is thus a key requirement for this flexibility. In E. coli, the fumarate and nitrate reduction (FNR) transcriptional regulator is responsible for sensing environmental levels of O2 and controlling the switch to anaerobic respiration false false _2349_ 29275 29275 9 false false YongJing Ping BBa_K1884006_sequence 1 gcggggccctgacaccactgcggccgccacctgccacatcatcatacgccgcgcctggacccgagggaggacccctcgggacccggtacgtcgtatgatgatgtggcaagtcttggtcgcggtggggtcaggtccttccgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z