BBa_J23111 1 BBa_J23111 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J18921 1 3xGS 6aa [GS]x linker 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis Highly flexible 6 amino acid linker. Translates to gsgsgs. Codon-optimize for E. coli, yeast, mammalian. false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_K1885002 1 BBa_K1885002 Gibson-assembled pSB1C3 with novel fusion osmY-PETase A0.58 2016-10-13T11:00:00Z 2016-10-29T11:17:00Z The pSB1C3 backbone, the Anderson promoter, and serine-glycine linker peptide parts came from the iGEM registry. The N-terminal osmY sequence came from the Escherischia Coli genome, found on NCBI, and the PETase protein came from the Ideonella sakaiensis genome, found on NCBI and annotated as ???lipase." PETase is a novel enzyme for the degradation of polyethylene terephthalate (PET) plastic. It was discovered in Ideonella sakaiensis, a bacteria species found by screening PET-exposed microbe communities in Japan. It functions as the first step in the degradation of PET; PETase catalyzes the hydrolysis of PET into terephthalate and ethylene glycol monomers. The N-terminal osmY protein and its signal peptide fused to PETase, with serine-glycine peptide repeats intervening, serves to secrete the PETase out of the cell so that it can act on PET in the cell's local environment. The Anderson promoter with a relative strength of 0.58 that precedes the fusion protein serves to constitutively express the fusion PETase, enhancing the degradation of environmental PET by the presence of more fusion PETase through constitutive expression. This part offers a more efficient initial step for teams interested in the bioremediation of PET, because the first step involved in PET bioremediation is hydrolysis into products that can then be utilized by a cell. Teams can then metabolically engineer bacteria of interest to metabolize ethylene glycol and terephthalate, but initially, these monomers must be produced by hydrolysis. Thus, PET bioremediation depends on the production of metabolizable monomers, and this part offers more efficient production of such monomers. This part utilizes the pSB1C3 backbone and confers resistance to chloramphenicol. true false _2350_ 29517 29517 9 false Designing this part required considering constitutive expression and promoter strength, secretion of the PETase, and maintaining an active PETase conformation. Respectively, the Anderson promoter, osmY, and serine-glycine linker peptide address the aforementioned considerations. false Kien Patrick Malarney component2502778 1 BBa_J18921 component2502779 1 BBa_J23111 annotation2502778 1 BBa_J18921 range2502778 1 1 18 annotation2502779 1 BBa_J23111 range2502779 1 27 61 BBa_K1885002_sequence 1 ggtagcggcagcggtagctactagagttgacggctagctcagtcctaggtatagtgctagc BBa_J23111_sequence 1 ttgacggctagctcagtcctaggtatagtgctagc BBa_J18921_sequence 1 ggtagcggcagcggtagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z