BBa_K188727 1 BBa_K188727 TetR repressible promoter ( weak ) 2009-10-18T11:00:00Z 2015-05-08T01:11:13Z TetR repressible promoter Part:BBa_R0040 Sequence for pTet inverting regulator. Promoter is constitutively ON and repressed by TetR. TetR repression is inhibited by the addition of tetracycline or its analog, aTc. This modified part use Degenerated PCR to make different TATA box at -10 sequences with original part. false false _296_ 0 5228 9 Not in stock false no false Hsiao-Yun Ko BBa_K188727_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatattgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z