BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1890031 1 BBa_K1890031 BolA gene with strong constitutive promoter, RBS and terminator 2016-10-12T11:00:00Z 2016-10-18T01:21:37Z E. coli Enter a long description of the part so that users of your part know what it is, what it does, and how to use it in their projects. false false _2355_ 29445 29445 9 false false Lycka Kamoen, Maria Vazquez component2498091 1 BBa_S03952 component2498093 1 BBa_B0010 component2498095 1 BBa_B0012 component2498092 1 BBa_K1890056 annotation2498092 1 BBa_K1890056 range2498092 1 62 382 annotation2498091 1 BBa_S03952 range2498091 1 1 55 annotation2498093 1 BBa_B0010 range2498093 1 391 470 annotation2498095 1 BBa_B0012 range2498095 1 479 519 BBa_K1890056 1 BBa_K1890056 BolA 2016-10-11T11:00:00Z 2016-10-18T01:23:48Z Scar between promoter and RBS false false _2355_ 29445 29445 9 false false Lycka Kamoen, Maria Vazquez BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_S03952 1 BBa_S03952 J23100:B0034 2008-06-21T11:00:00Z 2015-05-08T01:14:33Z Released HQ 2013 false true _187_ 0 3112 9 In stock false false Allen Lin component1964070 1 BBa_B0034 component1964068 1 BBa_J23100 annotation1964070 1 BBa_B0034 range1964070 1 44 55 annotation1964068 1 BBa_J23100 range1964068 1 1 35 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_S03952_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1890056_sequence 1 atgatgatacgtgagcggatagaagaaaaattaagggcggcgttccaacccgtattcctcgaagtagtggatgaaagctatcgtcacaatgtcccagccggctctgaaagccattttaaagttgtgctggtcagcgatcgttttacgggtgaacgttttctgaatcgtcatcgaatgatttacagtactttagcggaggaactctctactaccgttcatgcgctggctctgcatacttacactattaaggagtgggaagggttgcaggacaccgtctttgcctctcctccctgtcgtggagcaggaagcatcgcgtaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K1890031_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgatgatacgtgagcggatagaagaaaaattaagggcggcgttccaacccgtattcctcgaagtagtggatgaaagctatcgtcacaatgtcccagccggctctgaaagccattttaaagttgtgctggtcagcgatcgttttacgggtgaacgttttctgaatcgtcatcgaatgatttacagtactttagcggaggaactctctactaccgttcatgcgctggctctgcatacttacactattaaggagtgggaagggttgcaggacaccgtctttgcctctcctccctgtcgtggagcaggaagcatcgcgtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z