BBa_K189067 1 BBa_K189067 GP20 of Bacteriophage Mu 2009-10-20T11:00:00Z 2015-05-08T01:11:14Z Bacteriophage Mu, Complete genome One CDS of Bacteriophage Mu, Complete genome Product=???gp20??? Note: hypothetical protein false false _290_ 0 4058 9 Not in stock false none false Teng Li BBa_K189067_sequence 1 atgtacagaaaattcagtgatgaatgtttcgggccgtccacgctgattaatgcgataaaagtgattgcccttgtggttctgataaccatcagtgccgtggtgtatctttctgtctgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z