BBa_K1892000 1 BBa_K1892000 yebf (a motor protein) + LL-37 2016-10-12T11:00:00Z 2016-10-19T02:41:31Z yebf: Escherichia coli (strain K12) LL-37:Homo Sapiens This is a part with only the coding sequence of yebf fused with LL-37. LL-37(also known as CAMP cathelicidin antimicrobial peptide, CAP18; CRAMP; HSD26; CAP-18; FALL39; FALL-39)is a Human antimicrobial peptide and the only member of Cathelicidin AMP family found in the human body. LL-37 is able to kill Gram negative and Gram positive bacteria, enveloped viruses, fungi, and even transformed or cancerous cells. yebf is a motor protein from Escherichia coli (strain K12). It can transport proteins fused to it through the bacterial cell membrane. In this case, yebf can transport LL-37 out of the cell membrane. false false _2357_ 24906 24906 9 false the linker false YingQi Wang BBa_K1892000_sequence 1 atgggaaaaagaggggcgtttttagggctgttgttggtttctgcctgcgcatcagttttcgctgccaataatgaaaccagcaagtcggtcactttcccaaagtgtgaaggtctggatgctgccggaattgccgcgagcgtaaaacgtgattatcaacaaaatcgcgtggcgcgctgggcagatgatcaaaaaattgtcggtcaggccgatcccgtggcttgggtcagtttgcaggacattcagggtaaagatgataaatggtcagtaccgctaaccgtgcgtggtaaaagtgccgatattcattaccaggtcagcgtggactgcaaagcgggaatggcggaatatcagcggcgtctgctgggtgatttcttccggaaatctaaagagaagattggcaaagagtttaaaagaattgtccagagaatcaaggattttttgcggaatcttgtacccaggacagagtcctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z