BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508149 1 BBa_R0010 component1508159 1 BBa_B0034 annotation1508159 1 BBa_B0034 range1508159 1 209 220 annotation1508149 1 BBa_R0010 range1508149 1 1 200 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1892001 1 BBa_K1892001 SDF-ELP(20) 2016-10-13T11:00:00Z 2016-10-19T02:47:17Z Humans a fusion protein which consists of the human growth factor SDF1 (Stromal cell-derived factor1 ) and an elastin- like peptide (ELP) false false _2357_ 24906 24906 9 false The repeated times of pentapeptides false YingQi Wang BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K1892005 1 BBa_K1892005 J04500+SDF-ELP(20)+B0015 2016-10-13T11:00:00Z 2016-10-20T03:05:10Z No. a fusion protein which consists of the human growth factor SDF1 (Stromal cell-derived factor1 ) and an elastin- like peptide (ELP) with an iPTG induced promoter, an RBS and a double terminator false false _2357_ 24906 24906 9 false The repeated times of pentapeptides of elastin-like-protein false YingQi Wang component2525103 1 BBa_J04500 component2525111 1 BBa_B0015 component2525104 1 BBa_K1892001 annotation2525104 1 BBa_K1892001 range2525104 1 227 853 annotation2525103 1 BBa_J04500 range2525103 1 1 220 annotation2525111 1 BBa_B0015 range2525111 1 862 990 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K1892001_sequence 1 atgaatgcgaaagtcgttgtcgtgctggtgttggtcttaactgcactgtgtttgtctgatggtaaaccggtgagtctttcgtaccgttgcccgtgccgtttcttcgaatcacatgttgctcgcgcgaacgtgaaacacctgaaaattttgaatacgccgaattgcgcactccagattgtggcgcgtctgaaaaacaataaccgccaggtatgcatcgaccctaaactgaagtggattcaagaatatcttgaaaaagcacttaacaaagcgggcgcgggcgcgggcccggaaggcggtggtggtggtagcggtggtggtggtagcgttccgggtaaaggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggttttggtgttccgggtaaaggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggttttggttaa BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1892005_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgaatgcgaaagtcgttgtcgtgctggtgttggtcttaactgcactgtgtttgtctgatggtaaaccggtgagtctttcgtaccgttgcccgtgccgtttcttcgaatcacatgttgctcgcgcgaacgtgaaacacctgaaaattttgaatacgccgaattgcgcactccagattgtggcgcgtctgaaaaacaataaccgccaggtatgcatcgaccctaaactgaagtggattcaagaatatcttgaaaaagcacttaacaaagcgggcgcgggcgcgggcccggaaggcggtggtggtggtagcggtggtggtggtagcgttccgggtaaaggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggttttggtgttccgggtaaaggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggtgttggtgttccgggttttggttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z