BBa_K1893013 1 STAR Small transcription activating RNA (STAR) 2016-10-13T11:00:00Z 2016-10-28T07:55:08Z more Stuff Stuff false false _2358_ 31815 31914 9 true Loads of Stuff false Akash Bhattacharjee annotation2528202 1 STAR-antisense RNA range2528202 1 1 68 annotation2528203 1 t500 range2528203 1 75 104 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K1893010 1 BBa_K1893010 Constitutive STAR (J23119+STAR) 2016-10-13T11:00:00Z 2016-10-28T07:55:52Z More Stuff Stuff false false _2358_ 31815 31914 9 false Lots of stuff false Akash Bhattacharjee, Gear Rotrattanadumrong component2528191 1 BBa_J23119 component2528192 1 BBa_K1893013 annotation2528191 1 BBa_J23119 range2528191 1 1 35 annotation2528192 1 BBa_K1893013 range2528192 1 36 139 BBa_K1893013_sequence 1 tgaactgtatacattccccgctgctccaacatttatacaactaattaaaacaattcactgtaaaaactggatctcaaagcccgccgaaaggcgggctttttttt BBa_K1893010_sequence 1 ttgacagctagctcagtcctaggtataatgctagctgaactgtatacattccccgctgctccaacatttatacaactaattaaaacaattcactgtaaaaactggatctcaaagcccgccgaaaggcgggctttttttt BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z