BBa_K1893029 1 pCin CinR inducible promoter (pCin) 2016-10-16T11:00:00Z 2016-10-27T02:32:53Z This part comes from the genomic sequence of Rhizobium. This is the promoter which is bound to by the transcriptional activator CinR. This is the form of the promoter that we characterized, and it differs in sequence from BBa_R0077. false false _2358_ 31914 32089 9 false Although another form of this promoter exists, we used this version in our characterization experiments. false Alyssa Henderson annotation2515529 1 pCin range2515529 1 1 74 BBa_K1893029_sequence 1 ggggcctatctgagggaatttacttccctatcagtgatagagatactgagcacatccctatcagtgatagagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z