BBa_K1893030 1 pLas LasR inducible promoter (pLas) 2016-10-17T11:00:00Z 2016-10-27T02:33:30Z This part comes from the genome of P. aeruginosa This is the region that is bound to by the transcriptional activator LasR. false false _2358_ 31914 32089 9 false Another part for pLas already exists. However, this is the version that we used in our constructs. false Alyssa Henderson annotation2517465 1 pLas range2517465 1 1 120 BBa_K1893030_sequence 1 cctttccgaaacgaaacaagttggattttgcacctaccagaactggtagttctgacctgtggctatcttcgaaggcatcgatattatgcacattggaactcttcatgacataacgccgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z