BBa_K1893031 1 STAR targe STAR target (pAD1.S5) 2016-10-21T11:00:00Z 2016-10-27T02:34:01Z This comes from the pAD1 attenuator sequence. When transcribed, it produces the sense RNA which is also complementary to the STAR-antisense RNA. In the absence of STAR, it forms a hairpin structure and and prevent transcription of the downstream coding sequence. false false _2358_ 31914 31815 9 false This was synthesised as a composite sequence including the j23119 promoter, SFGFP and TrrnB terminator. false Akash Bhattacharjee BBa_K1893031_sequence 1 agtttttacagtgaattgttttaattagttgtataaatgttggagcagcggggaatgtatacagttcatgtatatattccccgcttttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z