BBa_K1893033 1 RBS Strong ribosome binding site (RBS) 2016-10-22T11:00:00Z 2016-10-27T02:35:55Z Same sequence that was used by James Chappell (Nature Chemical Biology, 2015) in designing the STAR reporter plasmid. Strong RBS false false _2358_ 31914 31815 9 false Was synthesized as a block with j23119, STAR-target, SFGFP, TrrnB false Akash Bhattacharjee BBa_K1893033_sequence 1 ggatctaggaggaaggatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z