BBa_K1894000 1 BBa_K1894000 Modified GvpA1 coding region 2016-10-10T11:00:00Z 2016-10-10T11:55:42Z Source: the genomic sequence of Microcystis aeruginosa The gene GvpA1 can express GvpA protein, which acts as the main structural protein of gas vesicle in Microcystis aeruginosa.Gas vesicle protein, which widely exists in all forms of planktonic cyanobacteria, provides cells with buoyancy by changing the density of cells and regulates their vertical distributions in natural waters, enabling them to achieve ideal vertical position in water for growth and subsequent niche colonization. Since floating and gathering together are the last and most critical stage in the formation of algae bloom,we mutate GvpA1 gene in order to limit the level of GvpA1 expression and change the conformation of gas vesicle protein---- a possible strategy to disrupt the distribution of microcysis in water and control algae bloom.By changing two base pairs, we mutate a serine to an alanine (hydrophilic amino acid to hydrophobic amino acid) and an alanine to a glycin. false false _2360_ 29417 29417 9 false By changing two base pairs(C-T,T-G), we mutate a serine to an alanine (hydrophilic amino acid to hydrophobic amino acid) and an alanine to a glycin,in order to limit the level of GvpA1 expression and change the conformation of gas vesicle protein. false Qinyu Ge BBa_K1894000_sequence 1 atggcagtggaaaaaaccaacagctcagcatctctgggtgaagtgattgaccgcatcctggacaaaggtatcgttattgacgcctgggcccgtgtcagcctggtgggcattgaactgctggcgatcgaagcccgcgtggttattgcgagcgtggaaacctatctgaaatacgctgaagcagtcggtctgacgcagtcggcagcggttccggcacaccatcaccatcaccattgataaaagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z