BBa_K1895003 1 BBa_K1895003 htpG Promoter 2016-09-05T11:00:00Z 2016-09-06T04:50:25Z This is a correction to part [http://parts.igem.org/Part:BBa_J45504 BBa_J45504], also the htpG Heat Shock Promoter. The original part contains a fragment of the coding sequence for molecular chaperone htpG (base pairs >287) which can be confirmed by [http://blast.ncbi.nlm.nih.gov/ BLASTing the sequence]. This part contains only the first 287 bases of the original part which consist solely of the htpG promoter. You can see the difference between the two sequences in the image below. [[File:T--Newcastle--htpG-Seq-Comparison.png]] This is the promoter for molecular chaperone htpG. It is active during the heat shock response. false false _2361_ 29859 29859 9 false [TODO] false iGEM16_Newcastle BBa_K1895003_sequence 1 cactgaagtgatcctcgccaccaaccccacggttgaaggtgaagctaccgctaactacattgccgagctttgcgcgcaatatgacgtggaagccagccgaatcgctcatggcgttccggttggcggcgagctggaaatggtcgacggcaccacgttgtcacactcccttgccgggcgtcataagattcgtttttaagcaaacgagagcaggatcacctgctctcgcttgaaattattctcccttgtccccatctctcccacatcctgtttttaaccttaaaatggca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z