BBa_K1896001 1 BBa_K1896001 mGFPuv2 2016-10-11T11:00:00Z 2016-10-14T05:25:03Z We started from pBAD-GFPuv (GenBank: U62637.1, Clontech), applied the described mutations and codon optimised the sequence for ''E. coli''. ===References=== # von Stetten, D., Noirclerc-Savoye, M., Goedhart, J., Gadella, T. W., & Royant, A. (2012). Structure of a fluorescent protein from ''Aequorea victoria'' bearing the obligate-monomer mutation A206K. ''Acta Crystallographica Section F: Structural Biology and Crystallization Communications'', 68(8), 878-882. # Ito, Y., Suzuki, M., & Husimi, Y. (1999). A novel mutant of green fluorescent protein with enhanced sensitivity for microanalysis at 488 nm excitation. ''Biochemical and biophysical research communications'', 264(2), 556-560. # Crameri, A., Whitehorn, E. A., Tate, E., Stemmer, W. P., Crameri, A., Kitts, P. A., & Kitts, P. A. (1996). Improved green fluorescent protein by molecular evolution using. ''Nat. Biotechnol'', 14(3), 315-319. Variant of Green Fluorescent Protein (GFP) that contains the following mutations: * '''F99S/M153T/V163A''': GFPuv or ''cycle 3'' GFP was optimised for excitation by UV light (360-400nm). [1] * '''S208L''': Almost doubles the fluorescent intensity of GFPuv, resulting in GFPuv2. [2] * '''A206K''': Monomerizes most GFP variants by disrupting a hydrophobic patch. [3] false false _2362_ 19009 19009 9 false After codon optimisation, 2 BsaI sites were removed. false Bob Van Hove, Maarten Van Brempt annotation2495309 1 stop range2495309 1 715 717 annotation2495318 1 A206K range2495318 1 616 618 annotation2495311 1 F99S range2495311 1 295 297 annotation2495308 1 start range2495308 1 1 3 annotation2495319 1 S208L range2495319 1 622 624 annotation2495310 1 mGFPuv2 range2495310 1 1 717 annotation2495317 1 V163A range2495317 1 487 489 annotation2495316 1 M153T range2495316 1 457 459 BBa_K1896001_sequence 1 atgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactggagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggctccgttcaactagcagaccattatcaacaaaatactccaattggtgatggccctgtccttttaccagacaaccattacctgtcgacacaatctaaacttttgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z