BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_S05356 1 BBa_S05356 S05355:K1896001 2016-10-12T11:00:00Z 2016-10-13T12:34:13Z false false _9_ 19009 19009 9 false false Bob Van Hove component2499237 1 BBa_K1896001 component2499228 1 BBa_S05355 annotation2499228 1 BBa_S05355 range2499228 1 1 55 annotation2499237 1 BBa_K1896001 range2499237 1 62 778 BBa_S05355 1 BBa_S05355 J23119:B0034 2016-10-12T11:00:00Z 2016-10-13T12:33:03Z false false _9_ 19009 19009 9 false false Bob Van Hove component2499223 1 BBa_B0034 component2499221 1 BBa_J23119 annotation2499223 1 BBa_B0034 range2499223 1 44 55 annotation2499221 1 BBa_J23119 range2499221 1 1 35 BBa_K1896001 1 BBa_K1896001 mGFPuv2 2016-10-11T11:00:00Z 2016-10-14T05:25:03Z We started from pBAD-GFPuv (GenBank: U62637.1, Clontech), applied the described mutations and codon optimised the sequence for ''E. coli''. ===References=== # von Stetten, D., Noirclerc-Savoye, M., Goedhart, J., Gadella, T. W., &amp; Royant, A. (2012). Structure of a fluorescent protein from ''Aequorea victoria'' bearing the obligate-monomer mutation A206K. ''Acta Crystallographica Section F: Structural Biology and Crystallization Communications'', 68(8), 878-882. # Ito, Y., Suzuki, M., &amp; Husimi, Y. (1999). A novel mutant of green fluorescent protein with enhanced sensitivity for microanalysis at 488 nm excitation. ''Biochemical and biophysical research communications'', 264(2), 556-560. # Crameri, A., Whitehorn, E. A., Tate, E., Stemmer, W. P., Crameri, A., Kitts, P. A., &amp; Kitts, P. A. (1996). Improved green fluorescent protein by molecular evolution using. ''Nat. Biotechnol'', 14(3), 315-319. Variant of Green Fluorescent Protein (GFP) that contains the following mutations: * '''F99S/M153T/V163A''': GFPuv or ''cycle 3'' GFP was optimised for excitation by UV light (360-400nm). [1] * '''S208L''': Almost doubles the fluorescent intensity of GFPuv, resulting in GFPuv2. [2] * '''A206K''': Monomerizes most GFP variants by disrupting a hydrophobic patch. [3] false false _2362_ 19009 19009 9 false After codon optimisation, 2 BsaI sites were removed. false Bob Van Hove, Maarten Van Brempt annotation2495316 1 M153T range2495316 1 457 459 annotation2495311 1 F99S range2495311 1 295 297 annotation2495308 1 start range2495308 1 1 3 annotation2495309 1 stop range2495309 1 715 717 annotation2495317 1 V163A range2495317 1 487 489 annotation2495319 1 S208L range2495319 1 622 624 annotation2495310 1 mGFPuv2 range2495310 1 1 717 annotation2495318 1 A206K range2495318 1 616 618 BBa_S05347 1 BBa_S05347 B0010:B0012 2016-10-11T11:00:00Z 2016-10-12T02:32:06Z false false _9_ 19009 19009 9 false false Bob Van Hove component2495232 1 BBa_B0010 component2495234 1 BBa_B0012 annotation2495232 1 BBa_B0010 range2495232 1 1 80 annotation2495234 1 BBa_B0012 range2495234 1 89 129 BBa_K1896010 1 BBa_K1896010 mGFPuv2 generator 2016-10-12T11:00:00Z 2016-10-14T05:26:07Z todo todo false false _2362_ 19009 19009 9 false todo false Bob Van Hove, Maarten Van Brempt component2499252 1 BBa_S05356 component2499259 1 BBa_S05347 annotation2499259 1 BBa_S05347 range2499259 1 787 915 annotation2499252 1 BBa_S05356 range2499252 1 1 778 BBa_S05355_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S05347_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K1896001_sequence 1 atgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactggagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggctccgttcaactagcagaccattatcaacaaaatactccaattggtgatggccctgtccttttaccagacaaccattacctgtcgacacaatctaaacttttgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa BBa_S05356_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactggagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggctccgttcaactagcagaccattatcaacaaaatactccaattggtgatggccctgtccttttaccagacaaccattacctgtcgacacaatctaaacttttgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_K1896010_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactggagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggctccgttcaactagcagaccattatcaacaaaatactccaattggtgatggccctgtccttttaccagacaaccattacctgtcgacacaatctaaacttttgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z