BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_S05347 1 BBa_S05347 B0010:B0012 2016-10-11T11:00:00Z 2016-10-12T02:32:06Z false false _9_ 19009 19009 9 false false Bob Van Hove component2495234 1 BBa_B0012 component2495232 1 BBa_B0010 annotation2495232 1 BBa_B0010 range2495232 1 1 80 annotation2495234 1 BBa_B0012 range2495234 1 89 129 BBa_K1896019 1 BBa_K1896019 pXS-GG 2016-10-12T11:00:00Z 2016-10-14T05:28:19Z todo todo false false _2362_ 19009 19009 9 false todo false Bob Van Hove, Maarten Van Brempt component2500085 1 BBa_S05355 component2500086 1 BBa_K1896009 component2500093 1 BBa_S05347 annotation2500085 1 BBa_S05355 range2500085 1 1 55 annotation2500086 1 BBa_K1896009 range2500086 1 62 83 annotation2500093 1 BBa_S05347 range2500093 1 92 220 BBa_S05355 1 BBa_S05355 J23119:B0034 2016-10-12T11:00:00Z 2016-10-13T12:33:03Z false false _9_ 19009 19009 9 false false Bob Van Hove component2499223 1 BBa_B0034 component2499221 1 BBa_J23119 annotation2499221 1 BBa_J23119 range2499221 1 1 35 annotation2499223 1 BBa_B0034 range2499223 1 44 55 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1896009 1 BBa_K1896009 BsaI MCS 2016-10-12T11:00:00Z 2016-10-13T12:30:38Z Fully synthetic. BsaI cloning site for Golden Gate cloning. false false _2362_ 19009 19009 9 false The spacer inbetween the diverging BsaI sites was designed for minimal secondary structure to allow this part to be built from annealed oligonucleotides. false Bob Van Hove annotation2502106 1 BsaI range2502106 1 5 10 annotation2502107 1 BsaI range2502107 1 16 21 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_S05355_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S05347_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K1896009_sequence 1 atgcgagaccaaaaaggtctcc BBa_K1896019_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagagaaagaggagaaatactagatgcgagaccaaaaaggtctcctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z