BBa_J23105 1 BBa_J23105 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1896009 1 BBa_K1896009 BsaI MCS 2016-10-12T11:00:00Z 2016-10-13T12:30:38Z Fully synthetic. BsaI cloning site for Golden Gate cloning. false false _2362_ 19009 19009 9 false The spacer inbetween the diverging BsaI sites was designed for minimal secondary structure to allow this part to be built from annealed oligonucleotides. false Bob Van Hove annotation2502107 1 BsaI range2502107 1 16 21 annotation2502106 1 BsaI range2502106 1 5 10 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_S05347 1 BBa_S05347 B0010:B0012 2016-10-11T11:00:00Z 2016-10-12T02:32:06Z false false _9_ 19009 19009 9 false false Bob Van Hove component2495234 1 BBa_B0012 component2495232 1 BBa_B0010 annotation2495232 1 BBa_B0010 range2495232 1 1 80 annotation2495234 1 BBa_B0012 range2495234 1 89 129 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_S05357 1 BBa_S05357 J23105:B0034 2016-10-12T11:00:00Z 2016-10-13T05:35:04Z false false _9_ 19009 19009 9 false false Bob Van Hove component2499763 1 BBa_B0034 component2499761 1 BBa_J23105 annotation2499761 1 BBa_J23105 range2499761 1 1 35 annotation2499763 1 BBa_B0034 range2499763 1 44 55 BBa_K1896020 1 BBa_K1896020 pXW-GG 2016-10-12T11:00:00Z 2016-10-14T05:28:37Z todo todo false false _2362_ 19009 19009 9 false todo false Bob Van Hove, Maarten Van Brempt component2500108 1 BBa_S05347 component2500100 1 BBa_S05357 component2500101 1 BBa_K1896009 annotation2500108 1 BBa_S05347 range2500108 1 92 220 annotation2500101 1 BBa_K1896009 range2500101 1 62 83 annotation2500100 1 BBa_S05357 range2500100 1 1 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_S05347_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1896020_sequence 1 tttacggctagctcagtcctaggtactatgctagctactagagaaagaggagaaatactagatgcgagaccaaaaaggtctcctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23105_sequence 1 tttacggctagctcagtcctaggtactatgctagc BBa_B0034_sequence 1 aaagaggagaaa BBa_S05357_sequence 1 tttacggctagctcagtcctaggtactatgctagctactagagaaagaggagaaa BBa_K1896009_sequence 1 atgcgagaccaaaaaggtctcc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z