BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1897000 1 BBa_K1897000 HasA hemophore coding sequence 2016-10-06T11:00:00Z 2016-10-09T10:00:00Z c c false false _2363_ 29428 29428 9 false d false Choi Yan Ru annotation2488977 1 Stop codon range2488977 1 583 585 annotation2488978 1 Hexa histadine tag range2488978 1 565 582 annotation2488976 1 Start codon range2488976 1 1 3 annotation2488995 1 HasA range2488995 1 1 564 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K525998 1 pT7 Promoter T7 and RBS 2011-09-12T11:00:00Z 2015-05-08T01:12:35Z Synthesis Released HQ 2013 Promoter T7 and RBS false false _690_ 0 8543 9 In stock false Synthesis false Anna Drong annotation2127788 1 B0034 range2127788 1 21 32 annotation2129432 1 T7 promoter range2129432 1 1 20 annotation2129433 1 RBS range2129433 1 24 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1897001 1 BBa_K1897001 HasA hemophore expression unit 2016-10-08T11:00:00Z 2016-10-10T03:37:25Z The HasA coding sequence is originally found in the Serratia marcescens and to construct this part, we used the HasA gene that is from the part BBa K1897000 which was synthesised based on the gene sequence from the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nlm.nih.gov/nuccore/X81195.2). The Promoter, RBS and terminator are biobrick parts that were obtained from the Distribution kits from iGEM. The HasA hemophore (19 kDa monomer) is originally from the Serratia marcescens and used in their heme uptake pathway. When bound to heme, the HasA hemophore is able to trigger expression of genes through the Has system. The heme-bound HasA hemophore is able to bind to a membrane receptor HasR, a component of the signalling cascade that regulates expression of the genes in the has operon via HasS and HasI. When HasR is activated, it causes a conformation change in HasS, an anti-sigma factor. This causes the release of the sigma factor, HasI, initially bound to it. HasI then goes on to bind to a specific promoter to trigger expression of genes under the control of that promoter. This is a composite part created from the coding sequence of HasA (BBa K1897000) with the addition of Bba_K525998, which contains a promoter and Ribosome Binding Site (RBS), and Bba_B0015, which contains a double terminator. The addition of these parts make BBa K1897001 a functional unit that can be used for expression, unlike BBa K1897000 which lacks the promoter, RBS and terminator and hence cannot be used on its own for expression. false false _2363_ 29428 29428 9 false The presence of a hexa histidine tag would allow for easy protein purification and detection using anti-his antibodies. The promoter BBa_K525998 was chosen as we wished to induce high levels of HasA for purification thus we required a T7 promoter that could be used to induce expression at high levels in E. coli strain BL21(DE3). The terminator BBa_B0015 was chosen as it is commonly used and has a high efficacy. false Choi Yan Ru component2489755 1 BBa_K1897000 component2489750 1 BBa_K525998 component2489762 1 BBa_B0015 annotation2489762 1 BBa_B0015 range2489762 1 632 760 annotation2489755 1 BBa_K1897000 range2489755 1 39 623 annotation2489750 1 BBa_K525998 range2489750 1 1 32 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1897001_sequence 1 taatacgactcactatagggaaagaggagaaatactagatggcattttcagtcaattatgacagcagcttcggcggttacagcattcatgactatctgggccagtgggcttcgacattcggtgatgtcaatcacaccaacggcaatgtcaccgacgccaacagcggcggcttctatggcggcagcctgtccggtagtcagtatgccatcagtagcacggcaaaccaggtgaccgccttcgtggcgggcggcaacctgacctacacgctgttcaacgaaccggcgcataccttgtacggccaactggattccctgtccttcggcgacggtttgagcggtggcgatacatcgccgtacagcatccaggtgcctgacgtcagcttcggcggcctgaacctcagcagcctacaagcgcagggtcatgatggcgtggtgcaccaggtggtgtacggcctgatgtccggcgataccggcgcgctggagaccgcgctgaacggcatcctcgacgactacggcctgagcgtcaactccaccttcgatcaggtggcggcggcgacggcggtgggcgtgcagcacgccgacagcccggaactgctggcggcccaccatcaccaccatcattgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K525998_sequence 1 taatacgactcactatagggaaagaggagaaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1897000_sequence 1 atggcattttcagtcaattatgacagcagcttcggcggttacagcattcatgactatctgggccagtgggcttcgacattcggtgatgtcaatcacaccaacggcaatgtcaccgacgccaacagcggcggcttctatggcggcagcctgtccggtagtcagtatgccatcagtagcacggcaaaccaggtgaccgccttcgtggcgggcggcaacctgacctacacgctgttcaacgaaccggcgcataccttgtacggccaactggattccctgtccttcggcgacggtttgagcggtggcgatacatcgccgtacagcatccaggtgcctgacgtcagcttcggcggcctgaacctcagcagcctacaagcgcagggtcatgatggcgtggtgcaccaggtggtgtacggcctgatgtccggcgataccggcgcgctggagaccgcgctgaacggcatcctcgacgactacggcctgagcgtcaactccaccttcgatcaggtggcggcggcgacggcggtgggcgtgcagcacgccgacagcccggaactgctggcggcccaccatcaccaccatcattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z