BBa_K190004 1 BBa_K190004 gvpB 2009-07-14T11:00:00Z 2015-05-08T01:11:14Z Bacillus megaterium, iGEM team Melbourne 2007 Gas vesicle gene identified in Bacillus megaterium, and forms part of the gvp cluster for gas vesicle formation. GvpB is thought to be one of the proteins forming the vesicle itself. false false _306_ 0 4144 9 Not in stock false None false Michael Verhoeven annotation2011499 1 gvpB range2011499 1 1 267 BBa_K190004_sequence 1 atgtctattcaaaaaagtactaatagttcaagtttagcagaagtcattgaccgtattttagataaaggaattgttattgatgcttttgcaagagtttctgttgtaggaattgaaattttaacgattgaagcgcgagtggttattgccagtgttgatacatggttacgctatgcagaagcagtagggcttcttcgtgacgacgtagaagaaaacggtcttcctgaacgttcaaattcaagtgaagggcagccgcgttttagtatttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z