BBa_K190015 1 pArsR Arsenic Promoter (ArsR regulated) 2009-07-14T11:00:00Z 2015-05-08T01:11:15Z E.coli TOP10 Promoter sequence with recognition site for ArsR transcriptional regulator protein. ArsR binds to the promoter sequence in the absence of As and releases on binding of As, therby activating transcription. false false _306_ 0 4144 9 In stock true None false Michael Verhoeven annotation2011502 1 -35 and -10 region range2011502 1 38 72 annotation2011501 1 ArsR binding site range2011501 1 9 41 BBa_K190015_sequence 1 ctgcacttacacattcgttaagtcatatatgtttttgacttatccgcttcgaagagagacactacctgcaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z