BBa_K190017 1 BBa_K190017 Copper Promoter (CueR regulated) 2009-07-14T11:00:00Z 2015-05-08T01:11:15Z E.coli TOP10 Promoter sequence with recognition site for CueR transcriptional regulator protein. false false _306_ 0 4144 9 It's complicated false None false Michael Verhoeven annotation2011506 1 CueR binding site range2011506 1 3 28 annotation2011505 1 -35 and -10 region range2011505 1 1 43 BBa_K190017_sequence 1 ttgaccttcccgtaaggggaaggactatgctcaacgtttgatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z