BBa_K190019 1 BBa_K190019 fMT 2009-08-18T11:00:00Z 2016-01-13T10:21:29Z fMT was cloned from pMAL-MT (kindly provided by Wilfred Chen, University of California), the origin of the gene is the genome of Fucus vesiculosus. fMT is a metallothionein binding Arsenite (III) and Arsenate(V), used to accumulate As when overexpressed. Binds As (III) stronger than As(V) Reference: Highly Selective and Rapid Arsenic Removal by Metabolically Engineered Escherichia coli Cells Expressing Fucus vesiculosus Metallothionein. Singh et al. App and Env Microbiology, May 2008, p. 2924???2927 false false _306_ 4206 4147 9 In stock true Add BioBrick prefix and suffix, add RBS (B0034) false Nienke Kuipers annotation2017543 1 fMT range2017543 1 19 222 annotation2017542 1 B0034` range2017542 1 1 18 BBa_K190019_sequence 1 aaagaggagaaatactagatggcgggcactggctgcaagatctgggaagactgcaagtgcggagcggcgtgcagctgcggcgactcgtgcacctgcggaactgtcaagaagggcaccacctctcgcgccggcgcgggctgcccctgcggccccaagtgcaaatgcaccggccaaggcagctgcaactgcgtcaaggacgactgctgcggctgcggcaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z