BBa_K190020 1 BBa_K190020 MymT 2009-08-18T11:00:00Z 2016-01-13T12:55:12Z MymT was cloned from pGB68 (kindly provided by Ben Gold, Cornell University), the gene's origin is the genome of ''M. tuberculosis'' MymT is a methallothionein binding Cu (II) false false _306_ 4206 4147 9 Not in stock false BioBrick prefix and suffix was added by PCR, also the RBS (B0034) was added by PCR (not in the sequence yet). false Nienke Kuipers annotation2017540 1 B0034 range2017540 1 1 18 annotation2017541 1 MymT range2017541 1 19 180 BBa_K190020_sequence 1 aaagaggagaaatactagatgagggtgatacgaatgacgaactacgaggctgggaccttgctgacctgtagccacgagggctgtggctgtcgggttcgcatcgaagtcccatgccactgtgctggcgccggtgacgcctaccgctgcacctgcggcgacgaattggccccggtcaagtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z