BBa_K190021 1 BBa_K190021 SmtA 2009-08-18T11:00:00Z 2016-01-13T12:54:44Z The gene was cloned from pET29a-SmtA (kindly provided by Kevin Waldron, Newcastle University), it's origin is from the genome of ''Synechococcus PC'' SmtA is a metallothionein that binds Zn (II) ions, it is able to bind 3-4 ions per protein. false false _306_ 4206 4147 9 Not in stock false The BioBrick prefix and suffix were added by PCR, also the RBS (B0034) was added. false Nienke Kuipers annotation2017544 1 B0034 range2017544 1 1 18 annotation2017545 1 SmtA range2017545 1 19 189 BBa_K190021_sequence 1 aaagaggagaaatactagatgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z