BBa_K190022 1 BBa_K190022 Zinc Promoter (ZntR regulated) with own RBS 2009-08-24T11:00:00Z 2015-05-08T01:11:15Z Strain: E.coli k.12 The pZntR from E.coli K.12 has a specific RBS site behind it in the genome. Here the RBS site is attachted to the promoter region. The RBS site might influence the activity of the promoter and will be tested in the same way as BBa_K190016. false false _306_ 0 4144 9 It's complicated false The short sequence did not contain any unwanted restriction sites. false Michael Verhoeven annotation2017703 1 RBS site range2017703 1 70 91 annotation2017704 1 -35 and -10 region range2017704 1 34 69 BBa_K190022_sequence 1 cgtccgctcgctgtatctctgataaaacttgactctggagtcgactccagagtgtatccttcggttaatgagaaaaaacttaaccggagga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z