BBa_K190021 1 BBa_K190021 SmtA 2009-08-18T11:00:00Z 2016-01-13T12:54:44Z The gene was cloned from pET29a-SmtA (kindly provided by Kevin Waldron, Newcastle University), it's origin is from the genome of ''Synechococcus PC'' SmtA is a metallothionein that binds Zn (II) ions, it is able to bind 3-4 ions per protein. false false _306_ 4206 4147 9 Not in stock false The BioBrick prefix and suffix were added by PCR, also the RBS (B0034) was added. false Nienke Kuipers annotation2017545 1 SmtA range2017545 1 19 189 annotation2017544 1 B0034 range2017544 1 1 18 BBa_K190030 1 BBa_K190030 SmtA with lacI regulated promotor 2009-09-01T11:00:00Z 2015-05-08T01:11:15Z SmtA: <partinfo>BBa_K190021</partinfo> LacI regulated promotor: <partinfo>BBa_R0010</partinfo> The metallothionein [[Part:BBa_K190021|SmtA]] under control of a LacI regulated promotor <partinfo>BBa_R0010</partinfo> false false _306_ 0 4145 9 Not in stock false [[Part:BBa_K190021|SmtA]]was put under several different promotors false Wilfred Poppinga component2218736 1 BBa_K190021 component2218727 1 BBa_R0010 annotation2218727 1 BBa_R0010 range2218727 1 1 200 annotation2218736 1 BBa_K190021 range2218736 1 209 397 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K190021_sequence 1 aaagaggagaaatactagatgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaa BBa_K190030_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgacctcaacaacgttggtcaaatgcgcttgtgagccctgtctctgcaacgtcgatcccagcaaagcgatcgatcgcaacggtctgtactactgcagcgaagcctgtgccgatggccacaccggtggtagcaaaggctgcggccacaccggctgtaactgccacggctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z