BBa_K190031 1 BBa_K190031 fMT with low constitutive promoter 2009-09-01T11:00:00Z 2015-05-08T01:11:15Z fMT: <partinfo>BBa_K190019</partinfo> low constitutive promotor: <partinfo>BBa_J23109</partinfo> The metallothionein [[Part:BBa_K190019|fMT]] under control of a low constitutive promotor <partinfo>BBa_J23109</partinfo> false false _306_ 0 4145 9 It's complicated false fMT was put under different promotors false Wilfred Poppinga component2018252 1 BBa_K190019 component2018249 1 BBa_J23109 annotation2018252 1 BBa_K190019 range2018252 1 44 265 annotation2018249 1 BBa_J23109 range2018249 1 1 35 BBa_J23109 1 BBa_J23109 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K190019 1 BBa_K190019 fMT 2009-08-18T11:00:00Z 2016-01-13T10:21:29Z fMT was cloned from pMAL-MT (kindly provided by Wilfred Chen, University of California), the origin of the gene is the genome of Fucus vesiculosus. fMT is a metallothionein binding Arsenite (III) and Arsenate(V), used to accumulate As when overexpressed. Binds As (III) stronger than As(V) Reference: Highly Selective and Rapid Arsenic Removal by Metabolically Engineered Escherichia coli Cells Expressing Fucus vesiculosus Metallothionein. Singh et al. App and Env Microbiology, May 2008, p. 2924???2927 false false _306_ 4206 4147 9 In stock true Add BioBrick prefix and suffix, add RBS (B0034) false Nienke Kuipers annotation2017542 1 B0034` range2017542 1 1 18 annotation2017543 1 fMT range2017543 1 19 222 BBa_J23109_sequence 1 tttacagctagctcagtcctagggactgtgctagc BBa_K190031_sequence 1 tttacagctagctcagtcctagggactgtgctagctactagagaaagaggagaaatactagatggcgggcactggctgcaagatctgggaagactgcaagtgcggagcggcgtgcagctgcggcgactcgtgcacctgcggaactgtcaagaagggcaccacctctcgcgccggcgcgggctgcccctgcggccccaagtgcaaatgcaccggccaaggcagctgcaactgcgtcaaggacgactgctgcggctgcggcaagtaa BBa_K190019_sequence 1 aaagaggagaaatactagatggcgggcactggctgcaagatctgggaagactgcaagtgcggagcggcgtgcagctgcggcgactcgtgcacctgcggaactgtcaagaagggcaccacctctcgcgccggcgcgggctgcccctgcggccccaagtgcaaatgcaccggccaaggcagctgcaactgcgtcaaggacgactgctgcggctgcggcaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z