BBa_K190019 1 BBa_K190019 fMT 2009-08-18T11:00:00Z 2016-01-13T10:21:29Z fMT was cloned from pMAL-MT (kindly provided by Wilfred Chen, University of California), the origin of the gene is the genome of Fucus vesiculosus. fMT is a metallothionein binding Arsenite (III) and Arsenate(V), used to accumulate As when overexpressed. Binds As (III) stronger than As(V) Reference: Highly Selective and Rapid Arsenic Removal by Metabolically Engineered Escherichia coli Cells Expressing Fucus vesiculosus Metallothionein. Singh et al. App and Env Microbiology, May 2008, p. 2924???2927 false false _306_ 4206 4147 9 In stock true Add BioBrick prefix and suffix, add RBS (B0034) false Nienke Kuipers annotation2017543 1 fMT range2017543 1 19 222 annotation2017542 1 B0034` range2017542 1 1 18 BBa_K190032 1 BBa_K190032 fMT with lacI regulated promotor 2009-09-01T11:00:00Z 2015-05-08T01:11:15Z LacI regulated promotor: <partinfo>BBa_R0010</partinfo> fMT: <partinfo>BBa_K190019</partinfo> The metallothionein [[Part:BBa_K190019|fMT]] uunder control of a LacI regulated promotor <partinfo>BBa_R0010</partinfo> false false _306_ 0 4145 9 It's complicated false fMT was put under the influence of different promotors false Wilfred Poppinga component2018263 1 BBa_K190019 component2018254 1 BBa_R0010 annotation2018263 1 BBa_K190019 range2018263 1 209 430 annotation2018254 1 BBa_R0010 range2018254 1 1 200 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K190032_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcgggcactggctgcaagatctgggaagactgcaagtgcggagcggcgtgcagctgcggcgactcgtgcacctgcggaactgtcaagaagggcaccacctctcgcgccggcgcgggctgcccctgcggccccaagtgcaaatgcaccggccaaggcagctgcaactgcgtcaaggacgactgctgcggctgcggcaagtaa BBa_K190019_sequence 1 aaagaggagaaatactagatggcgggcactggctgcaagatctgggaagactgcaagtgcggagcggcgtgcagctgcggcgactcgtgcacctgcggaactgtcaagaagggcaccacctctcgcgccggcgcgggctgcccctgcggccccaagtgcaaatgcaccggccaaggcagctgcaactgcgtcaaggacgactgctgcggctgcggcaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z