BBa_K1159101 1 BBa_K1159101 N-terminal half of TEV Protease S219V mutant (for Split-TEV-Protease applications) in RFC[25] 2013-09-13T11:00:00Z 2015-05-08T01:09:31Z ''Tabacco Etch Virus'' N-terminal half of the TEV Protease (autolysis resistant S219V mutant) can be used for Split-TEV-Protease applications where autolysis of the reconstituted TEV Protease is not wanted. The necessary C-terminal half can be found under BBa_K1159102. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2341473 1 N-terminal half of TEV Protease range2341473 1 1 354 BBa_K1362400 1 NpuDnaE(N) NpuDnaE N-Intein cloning piece 2014-10-05T11:00:00Z 2015-05-08T01:10:05Z Obtained from pVS07 by Prof. Henning D. Mootz, University of Muenster. Nostoc punctiforme DnaE split Intein N-terminal half. This is a DNA piece for cloning used to assemble other BioBrick parts. false false _1738_ 0 12377 9 Not in stock false This part represents only the intein sequence without inluding the standard splicing-site or polyglycine-linker overhangs. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1903005 1 BBa_K1903005 Split TEV N-IntN DnaE 2016-10-13T11:00:00Z 2016-10-18T01:06:22Z No Split TEV-IntN DnaE false false _2369_ 29474 29450 9 false None false Sof??a Vieto Fonseca component2516120 1 BBa_B0015 component2516112 1 BBa_K1159101 component2516113 1 BBa_K1362400 annotation2516112 1 BBa_K1159101 range2516112 1 1 354 annotation2516120 1 BBa_B0015 range2516120 1 673 801 annotation2516113 1 BBa_K1362400 range2516113 1 363 664 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1362400_sequence 1 taagctatgaaacggaaatattgacagtagaatatggattattaccgattggtaaaattgtagaaaagcgcatcgaatgtactgtttatagcgttgataataatggaaatatttatacacaacctgtagcacaatggcacgatcgcggagaacaagaggtgtttgagtattgtttggaagatggttcattgattcgggcaacaaaagaccataagtttatgactgttgatggtcaaatgttgccaattgatgaaatatttgaacgtgaattggatttgatgcgggttgataatttgccgaat BBa_K1159101_sequence 1 ggagaaagcttgtttaaggggccgcgtgattacaacccgatatcgagcaccatttgtcatttgacgaatgaatctgatgggcacacaacatcgttgtatggtattggatttggtcccttcatcattacaaacaagcacttgtttagaagaaataatggaacactgttggtccaatcactacatggtgtattcaaggtcaagaacaccacgactttgcaacaacacctcattgatgggagggacatgataattattcgcatgcctaaggatttcccaccatttcctcaaaagctgaaatttagagagccacaaagggaagagcgcatatgtcttgtgacaaccaacttccaaact BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1903005_sequence 1 ggagaaagcttgtttaaggggccgcgtgattacaacccgatatcgagcaccatttgtcatttgacgaatgaatctgatgggcacacaacatcgttgtatggtattggatttggtcccttcatcattacaaacaagcacttgtttagaagaaataatggaacactgttggtccaatcactacatggtgtattcaaggtcaagaacaccacgactttgcaacaacacctcattgatgggagggacatgataattattcgcatgcctaaggatttcccaccatttcctcaaaagctgaaatttagagagccacaaagggaagagcgcatatgtcttgtgacaaccaacttccaaacttactagagtaagctatgaaacggaaatattgacagtagaatatggattattaccgattggtaaaattgtagaaaagcgcatcgaatgtactgtttatagcgttgataataatggaaatatttatacacaacctgtagcacaatggcacgatcgcggagaacaagaggtgtttgagtattgtttggaagatggttcattgattcgggcaacaaaagaccataagtttatgactgttgatggtcaaatgttgccaattgatgaaatatttgaacgtgaattggatttgatgcgggttgataatttgccgaattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z