BBa_K1159101 1 BBa_K1159101 N-terminal half of TEV Protease S219V mutant (for Split-TEV-Protease applications) in RFC[25] 2013-09-13T11:00:00Z 2015-05-08T01:09:31Z ''Tabacco Etch Virus'' N-terminal half of the TEV Protease (autolysis resistant S219V mutant) can be used for Split-TEV-Protease applications where autolysis of the reconstituted TEV Protease is not wanted. The necessary C-terminal half can be found under BBa_K1159102. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2341473 1 N-terminal half of TEV Protease range2341473 1 1 354 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1362400 1 NpuDnaE(N) NpuDnaE N-Intein cloning piece 2014-10-05T11:00:00Z 2015-05-08T01:10:05Z Obtained from pVS07 by Prof. Henning D. Mootz, University of Muenster. Nostoc punctiforme DnaE split Intein N-terminal half. This is a DNA piece for cloning used to assemble other BioBrick parts. false false _1738_ 0 12377 9 Not in stock false This part represents only the intein sequence without inluding the standard splicing-site or polyglycine-linker overhangs. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_K1903006 1 BBa_K1903006 Split TEV N-IntN DnaE Device 2016-10-13T11:00:00Z 2016-10-18T01:08:10Z No Split TEV-IntN DnaE Device false false _2369_ 29474 29450 9 false None false Sof??a Vieto Fonseca component2516134 1 BBa_K1362400 component2516123 1 BBa_R0010 component2516131 1 BBa_B0034 component2516133 1 BBa_K1159101 component2516141 1 BBa_B0015 annotation2516134 1 BBa_K1362400 range2516134 1 591 892 annotation2516141 1 BBa_B0015 range2516141 1 901 1029 annotation2516131 1 BBa_B0034 range2516131 1 209 220 annotation2516123 1 BBa_R0010 range2516123 1 1 200 annotation2516133 1 BBa_K1159101 range2516133 1 229 582 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K1362400_sequence 1 taagctatgaaacggaaatattgacagtagaatatggattattaccgattggtaaaattgtagaaaagcgcatcgaatgtactgtttatagcgttgataataatggaaatatttatacacaacctgtagcacaatggcacgatcgcggagaacaagaggtgtttgagtattgtttggaagatggttcattgattcgggcaacaaaagaccataagtttatgactgttgatggtcaaatgttgccaattgatgaaatatttgaacgtgaattggatttgatgcgggttgataatttgccgaat BBa_K1903006_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagagggagaaagcttgtttaaggggccgcgtgattacaacccgatatcgagcaccatttgtcatttgacgaatgaatctgatgggcacacaacatcgttgtatggtattggatttggtcccttcatcattacaaacaagcacttgtttagaagaaataatggaacactgttggtccaatcactacatggtgtattcaaggtcaagaacaccacgactttgcaacaacacctcattgatgggagggacatgataattattcgcatgcctaaggatttcccaccatttcctcaaaagctgaaatttagagagccacaaagggaagagcgcatatgtcttgtgacaaccaacttccaaacttactagagtaagctatgaaacggaaatattgacagtagaatatggattattaccgattggtaaaattgtagaaaagcgcatcgaatgtactgtttatagcgttgataataatggaaatatttatacacaacctgtagcacaatggcacgatcgcggagaacaagaggtgtttgagtattgtttggaagatggttcattgattcgggcaacaaaagaccataagtttatgactgttgatggtcaaatgttgccaattgatgaaatatttgaacgtgaattggatttgatgcgggttgataatttgccgaattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1159101_sequence 1 ggagaaagcttgtttaaggggccgcgtgattacaacccgatatcgagcaccatttgtcatttgacgaatgaatctgatgggcacacaacatcgttgtatggtattggatttggtcccttcatcattacaaacaagcacttgtttagaagaaataatggaacactgttggtccaatcactacatggtgtattcaaggtcaagaacaccacgactttgcaacaacacctcattgatgggagggacatgataattattcgcatgcctaaggatttcccaccatttcctcaaaagctgaaatttagagagccacaaagggaagagcgcatatgtcttgtgacaaccaacttccaaact BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z