BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1159102 1 BBa_K1159102 C-terminal half of TEV Protease S219V mutant (for Split-TEV-Protease applications) in RFC[25] 2013-09-13T11:00:00Z 2015-05-08T01:09:31Z Tabacco Etch Virus C-terminal half of the TEV Protease (autolysis resistant S219V mutant) can be used for Split-TEV-Protease applications where autolysis of the reconstituted TEV Protease is not wanted. The necessary N-terminal half can be found under BBa_K1159101. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2341475 1 Ser --> Val for autolysis resistance range2341475 1 301 303 annotation2341474 1 C-terminal half of TEV Protease range2341474 1 1 354 BBa_K1362401 1 NpuDnaE(C) NpuDnaE C-Intein cloning piece 2014-10-05T11:00:00Z 2015-05-08T01:10:05Z Obtained from pVS41 by Prof. Henning D. Mootz, University of Muenster. Nostoc punctiforme DnaE split Intein C-terminal half. This is a DNA piece for cloning used to assemble our other BioBrick parts. false false _1738_ 0 12377 9 Not in stock false This part represents only the intein sequence without inluding the standard splicing-site or polyglycine-linker overhangs. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1903008 1 BBa_K1903008 Split TEV-IntC DnaE Device 2016-10-13T11:00:00Z 2016-10-18T02:15:44Z NO Split TEV-IntC DnaE false false _2369_ 29474 29450 9 false None false Sof??a Vieto Fonseca component2516589 1 BBa_B0015 component2516582 1 BBa_K1159102 component2516576 1 BBa_J23101 component2516579 1 BBa_K1362401 component2516578 1 BBa_B0034 annotation2516578 1 BBa_B0034 range2516578 1 44 55 annotation2516589 1 BBa_B0015 range2516589 1 535 663 annotation2516582 1 BBa_K1159102 range2516582 1 173 526 annotation2516576 1 BBa_J23101 range2516576 1 1 35 annotation2516579 1 BBa_K1362401 range2516579 1 64 164 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1159102_sequence 1 aagagcatgtctagcatggtgtcagacactagctgcacattcccttcatctgatggcatattctggaagcattggattcaaaccaaggatgggcagtgtggcagtccattagtatcaactagagatgggttcattgttggtatacactcagcatcgaatttcaccaacacaaacaattatttcacaagcgtgccgaaaaacttcatggaattgttgacaaatcaggaggcgcagcagtgggttagtggttggcgattaaatgctgactcagtattgtgggggggccataaagttttcatggtgaaacctgaagagccttttcagccagttaaggaagcgactcaactcatgaat BBa_K1362401_sequence 1 atcaaaatagccacacgtaaatatttaggcaaacaaaatgtctatgacattggagttgagcgcgaccataattttgcactcaaaaatggcttcatagcttc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1903008_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagaaagaggagaaatactagagatcaaaatagccacacgtaaatatttaggcaaacaaaatgtctatgacattggagttgagcgcgaccataattttgcactcaaaaatggcttcatagcttctactagagaagagcatgtctagcatggtgtcagacactagctgcacattcccttcatctgatggcatattctggaagcattggattcaaaccaaggatgggcagtgtggcagtccattagtatcaactagagatgggttcattgttggtatacactcagcatcgaatttcaccaacacaaacaattatttcacaagcgtgccgaaaaacttcatggaattgttgacaaatcaggaggcgcagcagtgggttagtggttggcgattaaatgctgactcagtattgtgggggggccataaagttttcatggtgaaacctgaagagccttttcagccagttaaggaagcgactcaactcatgaattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z