BBa_K1903019 1 BBa_K1903019 Intein N SSp DnaB S1 2016-10-16T11:00:00Z 2016-10-17T08:06:56Z The sequence of amino acids: LRESGCISGDSLISLA was reverse translate to E. coli The amino acid sequence was obtained from: Volkmann, G., Volkmann, V., & Liu, X. Q. (2012). Site‐specific protein cleavage in vivo by an intein‐derived protease. FEBS letters, 586(1), 79-84. This part is composed by the 11 amino acids from the SSp DnaB Intein N and 5 amino acids from the original Extein false false _2369_ 29474 29474 9 false Reverse translate to the organism of interest. Needs an ATG codon to start transcription if wanted to express itself apart. false Rafael Montenegro Mar??n annotation2516424 1 Int N DnaB range2516424 1 1 48 BBa_K1903019_sequence 1 ctgcgcgaaagcggctgcattagcggcgatagcctgattagcctggcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z