BBa_K1904007 1 BBa_K1904007 TAT signal peptide (RFC 25 N-part) 2016-06-06T11:00:00Z 2016-06-07T06:44:29Z Optimized for E.coli Twin arginine signal peptide is an efficient protein export signal sequence of E. coli. false false _2370_ 29496 29496 9 false This sequence was optimised for its usage in RFC 25 standard and in E. coli as chassis. false Enrique Chimal Juarez, Roger Milton Rubio S??nchez, Enrique Palomino, Brian Morteo annotation2480052 1 TAT range2480052 1 1 90 BBa_K1904007_sequence 1 atggacaaattcgacgctaatcgccgcaaattgctggcgcttggtggcgttgcactcggtgccgccatcctgccgacccctgcgtttgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z