BBa_K1905001 1 BBa_K1905001 Riboswitch to detect L1 mRNA from HPV 2016-09-12T11:00:00Z 2016-09-13T08:56:24Z It does not come from a genomic sequence, it assembled and engineered in order to fold and unfold in presence or absence of L1 mRNA. DNA coding for a riboswitch to detect L1 mRNA from Human Papillomavirus. This part includes a promoter (BB_R0010) and a RBS (BBa_B0034), the reverse complementary for a section of L1 DNA coding region, and the original sequence with one base changed. When there is presence of L1 mRNA, the riboswitch turns on and it allows the expression of a reporter protein. false false _2371_ 26350 26350 9 false The main design consideration is the proper fold of the mRNA and hybridization with L1 mRNA. false Juan Carlos Rueda Silva BBa_K1905001_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacagaaaaccaaacttattggggtcaggtaaagcacagagaaaagaggagaaaaagcacagagatacctgaccgcaataagtttgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z