BBa_K1905002 1 BBa_K1905002 Riboswitch to detect E6 mRNA from HPV 2016-09-12T11:00:00Z 2016-09-13T09:00:33Z It does not come from a genomic sequence, it assembled and engineered in order to fold and unfold in presence or absence of E6 mRNA. DNA coding for a riboswitch to detect E6 mRNA from Human Papillomavirus type 16 and type 18. This part includes a promoter (BB_R0010) and a RBS (BBa_B0034), the reverse complementary for a section of E6 DNA coding region, and the original sequence with one base changed. When there is presence of E6 mRNA, the riboswitch turns on and it allows the expression of a reporter protein. false false _2371_ 26350 26350 9 false The main design consideration is the proper fold of the mRNA and hybridization with E6 mRNA. false Juan Carlos Rueda Silva BBa_K1905002_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacattttagaataaaactttaaacatttataagcacagagaaaagaggagaaaaagcacagagaataaatgtttaaagttatattc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z