BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_K081005 1 BBa_K081005 constitutive promoter family member and RBS 2008-10-17T11:00:00Z 2015-05-08T01:08:34Z Promoter: John Anderson. RBS: Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. Released HQ 2013 Constitutive promoter (strong) with RBS (strong, efficiency=0.3) false true _227_ 0 2583 9 In stock true We used BioBrick Standard Assembly. true Lorenzo Pasotti, Paolo Magni component1981865 1 BBa_B0030 component1981863 1 BBa_J23100 annotation1981865 1 BBa_B0030 range1981865 1 44 58 annotation1981863 1 BBa_J23100 range1981863 1 1 35 BBa_K1909007 1 BBa_K1909007 Strong Anderson / mTaz 2016-10-13T11:00:00Z 2016-10-14T11:41:12Z Composite Part Coming soon false false _2375_ 0 29525 29525 9 It's complicated false Coming soon false Daniel Wedemeyer component2507545 1 BBa_K081005 component2507551 1 BBa_K1909002 annotation2507545 1 BBa_K081005 range2507545 1 1 58 annotation2507551 1 BBa_K1909002 range2507551 1 65 1516 BBa_K1909002 1 mTaz mTaz (Taz-derived mDAP receptor) 2016-10-13T11:00:00Z 2016-10-14T10:47:39Z mTaz is based on the Tar-EnvZ chimeric receptor which is capable of detecting aspartate in the medium as described by Utsumi et al. 1989. Tar, or methyl-accepting chemotaxis protein II, is a signal transducer in Escherichia coli chemotaxis and is activated upon the recognition of aspartate. Tar is sensitive to mutations altering its ligand specificity which sometimes results in recognizing other amino acids. EnvZ is a part of the well-studied and commonly used two-component system EnvZ/OmpR in E. coli, offering a simple way of signal transduction. Its periplasmic domain was shown to be exchangeable with different sensor domains e.g. Tar/EnvZ chimeric receptor capable of detecting aspartate in the medium. Coming as soon as we validated mTaz. false false _2375_ 29525 29525 9 false meso-2,6-Diaminopimelic acid (mDAP) is a non-proteinogenic amino acid that is synthesized and se-creted by Chlamydia trachomatis. mDAP has a relatively high chemical similarity to aspartate, sharing a Tanimoto coefficient of T=0.8 in a molecular fingerprint analysis [T<0: chemically very different struc-tures; T=1: identity]. As a proof of concept, a molecular docking model proposes few mutations which would change the Tar specificity towards mDAP. As input for molecular docking we used the crys-tal structure of the ligand binding domain of Tar bound to aspartate (PDB: 4Z9H). As a base for the part sequence, the BioBrick representation of the original Taz, BBa_C0082, was used. The BBa_C0082 BioBrick features a small part of the vector (64 nucleotides) it was derived from on its 3??? end, which we have removed along with the stop codon inside the Part for further fusion protein de-sign in RFC 12, 21, 23 and 25 assembly standards. We used the Glide algorithm, Maestro and the Schrodinger Suite for molecular docking of aspartate and mDAP to the Tar ligand binding domain (PDB: 4Z9H). Because of its structural similarity to aspartate, mDAP showed some affinity to the native Tar aspartate binding site (Table 1). Since mDAP is larger than aspartate, Y149 led to structural interference, not allowing mDAP to fully enter the binding site. To create the additional space needed for mDAP binding, we substituted Y149 with smaller amino acids. The best results were obtained with serine. Because of the additional size of mDAP, the bigger challenge was to reduce the affinity of aspartate rather than to raise the affinity of mDAP. We identified R64 as a key residue for aspartate binding which hovewer was not needed to bind mDAP. To minimally interfere with folding and function we performed a constitutive substitution and substituted it with lysine, creating the R64K Y149S double mutant called mTaz hereafter. Using mTaz, a higher docking score was achieved for mDAP than for aspartate (Table 1). false Daniel Wedemeyer, Alp Mirdo&#287;an annotation2506923 1 R64K range2506923 1 190 192 annotation2506924 1 Y149S range2506924 1 445 447 annotation2506922 1 EnvZ range2506922 1 766 1452 annotation2506919 1 Tar range2506919 1 1 765 annotation2506915 1 mTaz range2506915 1 1 1452 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K081005_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaa BBa_B0030_sequence 1 attaaagaggagaaa BBa_K1909007_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagattaaagaggagaaatactagatgattaaccgtatccgcgtagtcacgctgttggtaatggtgctgggggtattcgcactgttacagcttatttccggcagtctgtttttttcttcccttcaccatagccagaagagctttgtggtttccaatcaattacgggaacagcagggcgagctgacgtcaacctgggatttaatgctgcaaacgaaaattaacctgagtcgttcagcggtacggatgatgatggattcctccaatcaacaaagtaacgccaaagttgaattgctcgatagcgccaggaaaacattggcgcaggcagcgacgcattataaaaaattcaaaagcatggcaccgttacctgaaatggtcgctaccagtcgtaatattgatgaaaaatataaaaactattacacagcgttaactgaactgattgattatctcgattatggcaatactggagcttctttcgctcagccaacccagggaatgcaaaatgcaatgggcgaagcgtttgctcagtacgccctcagcagtgaaaaactgtatcgcgatatcgtcactgacaacgcagatgattaccgatttgcccagtggcaactggcggttatcgcgctggtggtggtattgattctgctggtggcgtggtacggcattcgccgtatgttgcttactccgctggcaaaaattattgctcacattcgcgaaatcgccggtggtaacctggcgaataccctgaccattgacgggcgcagtgaaatgggcgacctggcgcagagcgtttcacatatggcggctggtgttaagcaactggcggatgaccgcacgctgctgatggcgggggtaagtcacgacttgcgcacgccgctgacgcgtattcgcctggcgactgagatgatgagcgagcaggatggctatctggcagaatcgatcaataaagatatcgaagagtgcaacgccatcattgagcagtttatcgactacctgcgcaccgggcaggagatgccgatggaaatggcggatcttaatgcagtactcggtgaggtgattgctgccgaaagtggctatgagcgggaaattgaaaccgcgctttaccccggcagcattgaagtgaaaatgcacccgctgtcgatcaaacgcgcggtggcgaatatggtggtcaacgccgcccgttatggcaatggctggatcaaagtcagcagcggaacggagccgaatcgcgcctggttccaggtggaagatgacggtccgggaattgcgccggaacaacgtaagcacctgttccagccgtttgtccgcggcgacagtgcgcgcaccattagcggcacgggattagggctggcaattgtgcagcgtatcgtggataaccataacgggatgctggagcttggcaccagcgagcggggcgggctttccattcgcgcctggctgccagtgccggtaacgcgggcgcagggcacgacaaaagaaggg BBa_K1909002_sequence 1 atgattaaccgtatccgcgtagtcacgctgttggtaatggtgctgggggtattcgcactgttacagcttatttccggcagtctgtttttttcttcccttcaccatagccagaagagctttgtggtttccaatcaattacgggaacagcagggcgagctgacgtcaacctgggatttaatgctgcaaacgaaaattaacctgagtcgttcagcggtacggatgatgatggattcctccaatcaacaaagtaacgccaaagttgaattgctcgatagcgccaggaaaacattggcgcaggcagcgacgcattataaaaaattcaaaagcatggcaccgttacctgaaatggtcgctaccagtcgtaatattgatgaaaaatataaaaactattacacagcgttaactgaactgattgattatctcgattatggcaatactggagcttctttcgctcagccaacccagggaatgcaaaatgcaatgggcgaagcgtttgctcagtacgccctcagcagtgaaaaactgtatcgcgatatcgtcactgacaacgcagatgattaccgatttgcccagtggcaactggcggttatcgcgctggtggtggtattgattctgctggtggcgtggtacggcattcgccgtatgttgcttactccgctggcaaaaattattgctcacattcgcgaaatcgccggtggtaacctggcgaataccctgaccattgacgggcgcagtgaaatgggcgacctggcgcagagcgtttcacatatggcggctggtgttaagcaactggcggatgaccgcacgctgctgatggcgggggtaagtcacgacttgcgcacgccgctgacgcgtattcgcctggcgactgagatgatgagcgagcaggatggctatctggcagaatcgatcaataaagatatcgaagagtgcaacgccatcattgagcagtttatcgactacctgcgcaccgggcaggagatgccgatggaaatggcggatcttaatgcagtactcggtgaggtgattgctgccgaaagtggctatgagcgggaaattgaaaccgcgctttaccccggcagcattgaagtgaaaatgcacccgctgtcgatcaaacgcgcggtggcgaatatggtggtcaacgccgcccgttatggcaatggctggatcaaagtcagcagcggaacggagccgaatcgcgcctggttccaggtggaagatgacggtccgggaattgcgccggaacaacgtaagcacctgttccagccgtttgtccgcggcgacagtgcgcgcaccattagcggcacgggattagggctggcaattgtgcagcgtatcgtggataaccataacgggatgctggagcttggcaccagcgagcggggcgggctttccattcgcgcctggctgccagtgccggtaacgcgggcgcagggcacgacaaaagaaggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z