BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_K608006 1 BBa_K608006 medium Promoter , medium RBS 2011-09-14T11:00:00Z 2015-05-08T01:12:52Z composite Released HQ 2013 medium Promotor , medium RBS false false _780_ 0 9115 9 In stock false composite false Julia M??ller component2128659 1 BBa_J23110 component2128661 1 BBa_B0032 annotation2128659 1 BBa_J23110 range2128659 1 1 35 annotation2128661 1 BBa_B0032 range2128661 1 44 56 BBa_J23110 1 BBa_J23110 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1909008 1 BBa_K1909008 Medium Anderson / mTaz 2016-10-13T11:00:00Z 2016-10-14T11:44:03Z Composite Part Coming soon false false _2375_ 29525 29525 9 false Coming soon false Daniel Wedemeyer component2507591 1 BBa_K608006 component2507597 1 BBa_K1909002 annotation2507591 1 BBa_K608006 range2507591 1 1 56 annotation2507597 1 BBa_K1909002 range2507597 1 63 1514 BBa_K1909002 1 mTaz mTaz (Taz-derived mDAP receptor) 2016-10-13T11:00:00Z 2016-10-14T10:47:39Z mTaz is based on the Tar-EnvZ chimeric receptor which is capable of detecting aspartate in the medium as described by Utsumi et al. 1989. Tar, or methyl-accepting chemotaxis protein II, is a signal transducer in Escherichia coli chemotaxis and is activated upon the recognition of aspartate. Tar is sensitive to mutations altering its ligand specificity which sometimes results in recognizing other amino acids. EnvZ is a part of the well-studied and commonly used two-component system EnvZ/OmpR in E. coli, offering a simple way of signal transduction. Its periplasmic domain was shown to be exchangeable with different sensor domains e.g. Tar/EnvZ chimeric receptor capable of detecting aspartate in the medium. Coming as soon as we validated mTaz. false false _2375_ 29525 29525 9 false meso-2,6-Diaminopimelic acid (mDAP) is a non-proteinogenic amino acid that is synthesized and se-creted by Chlamydia trachomatis. mDAP has a relatively high chemical similarity to aspartate, sharing a Tanimoto coefficient of T=0.8 in a molecular fingerprint analysis [T<0: chemically very different struc-tures; T=1: identity]. As a proof of concept, a molecular docking model proposes few mutations which would change the Tar specificity towards mDAP. As input for molecular docking we used the crys-tal structure of the ligand binding domain of Tar bound to aspartate (PDB: 4Z9H). As a base for the part sequence, the BioBrick representation of the original Taz, BBa_C0082, was used. The BBa_C0082 BioBrick features a small part of the vector (64 nucleotides) it was derived from on its 3??? end, which we have removed along with the stop codon inside the Part for further fusion protein de-sign in RFC 12, 21, 23 and 25 assembly standards. We used the Glide algorithm, Maestro and the Schrodinger Suite for molecular docking of aspartate and mDAP to the Tar ligand binding domain (PDB: 4Z9H). Because of its structural similarity to aspartate, mDAP showed some affinity to the native Tar aspartate binding site (Table 1). Since mDAP is larger than aspartate, Y149 led to structural interference, not allowing mDAP to fully enter the binding site. To create the additional space needed for mDAP binding, we substituted Y149 with smaller amino acids. The best results were obtained with serine. Because of the additional size of mDAP, the bigger challenge was to reduce the affinity of aspartate rather than to raise the affinity of mDAP. We identified R64 as a key residue for aspartate binding which hovewer was not needed to bind mDAP. To minimally interfere with folding and function we performed a constitutive substitution and substituted it with lysine, creating the R64K Y149S double mutant called mTaz hereafter. Using mTaz, a higher docking score was achieved for mDAP than for aspartate (Table 1). false Daniel Wedemeyer, Alp Mirdo&#287;an annotation2506923 1 R64K range2506923 1 190 192 annotation2506924 1 Y149S range2506924 1 445 447 annotation2506922 1 EnvZ range2506922 1 766 1452 annotation2506919 1 Tar range2506919 1 1 765 annotation2506915 1 mTaz range2506915 1 1 1452 BBa_K1909008_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatgattaaccgtatccgcgtagtcacgctgttggtaatggtgctgggggtattcgcactgttacagcttatttccggcagtctgtttttttcttcccttcaccatagccagaagagctttgtggtttccaatcaattacgggaacagcagggcgagctgacgtcaacctgggatttaatgctgcaaacgaaaattaacctgagtcgttcagcggtacggatgatgatggattcctccaatcaacaaagtaacgccaaagttgaattgctcgatagcgccaggaaaacattggcgcaggcagcgacgcattataaaaaattcaaaagcatggcaccgttacctgaaatggtcgctaccagtcgtaatattgatgaaaaatataaaaactattacacagcgttaactgaactgattgattatctcgattatggcaatactggagcttctttcgctcagccaacccagggaatgcaaaatgcaatgggcgaagcgtttgctcagtacgccctcagcagtgaaaaactgtatcgcgatatcgtcactgacaacgcagatgattaccgatttgcccagtggcaactggcggttatcgcgctggtggtggtattgattctgctggtggcgtggtacggcattcgccgtatgttgcttactccgctggcaaaaattattgctcacattcgcgaaatcgccggtggtaacctggcgaataccctgaccattgacgggcgcagtgaaatgggcgacctggcgcagagcgtttcacatatggcggctggtgttaagcaactggcggatgaccgcacgctgctgatggcgggggtaagtcacgacttgcgcacgccgctgacgcgtattcgcctggcgactgagatgatgagcgagcaggatggctatctggcagaatcgatcaataaagatatcgaagagtgcaacgccatcattgagcagtttatcgactacctgcgcaccgggcaggagatgccgatggaaatggcggatcttaatgcagtactcggtgaggtgattgctgccgaaagtggctatgagcgggaaattgaaaccgcgctttaccccggcagcattgaagtgaaaatgcacccgctgtcgatcaaacgcgcggtggcgaatatggtggtcaacgccgcccgttatggcaatggctggatcaaagtcagcagcggaacggagccgaatcgcgcctggttccaggtggaagatgacggtccgggaattgcgccggaacaacgtaagcacctgttccagccgtttgtccgcggcgacagtgcgcgcaccattagcggcacgggattagggctggcaattgtgcagcgtatcgtggataaccataacgggatgctggagcttggcaccagcgagcggggcgggctttccattcgcgcctggctgccagtgccggtaacgcgggcgcagggcacgacaaaagaaggg BBa_K608006_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaag BBa_B0032_sequence 1 tcacacaggaaag BBa_J23110_sequence 1 tttacggctagctcagtcctaggtacaatgctagc BBa_K1909002_sequence 1 atgattaaccgtatccgcgtagtcacgctgttggtaatggtgctgggggtattcgcactgttacagcttatttccggcagtctgtttttttcttcccttcaccatagccagaagagctttgtggtttccaatcaattacgggaacagcagggcgagctgacgtcaacctgggatttaatgctgcaaacgaaaattaacctgagtcgttcagcggtacggatgatgatggattcctccaatcaacaaagtaacgccaaagttgaattgctcgatagcgccaggaaaacattggcgcaggcagcgacgcattataaaaaattcaaaagcatggcaccgttacctgaaatggtcgctaccagtcgtaatattgatgaaaaatataaaaactattacacagcgttaactgaactgattgattatctcgattatggcaatactggagcttctttcgctcagccaacccagggaatgcaaaatgcaatgggcgaagcgtttgctcagtacgccctcagcagtgaaaaactgtatcgcgatatcgtcactgacaacgcagatgattaccgatttgcccagtggcaactggcggttatcgcgctggtggtggtattgattctgctggtggcgtggtacggcattcgccgtatgttgcttactccgctggcaaaaattattgctcacattcgcgaaatcgccggtggtaacctggcgaataccctgaccattgacgggcgcagtgaaatgggcgacctggcgcagagcgtttcacatatggcggctggtgttaagcaactggcggatgaccgcacgctgctgatggcgggggtaagtcacgacttgcgcacgccgctgacgcgtattcgcctggcgactgagatgatgagcgagcaggatggctatctggcagaatcgatcaataaagatatcgaagagtgcaacgccatcattgagcagtttatcgactacctgcgcaccgggcaggagatgccgatggaaatggcggatcttaatgcagtactcggtgaggtgattgctgccgaaagtggctatgagcgggaaattgaaaccgcgctttaccccggcagcattgaagtgaaaatgcacccgctgtcgatcaaacgcgcggtggcgaatatggtggtcaacgccgcccgttatggcaatggctggatcaaagtcagcagcggaacggagccgaatcgcgcctggttccaggtggaagatgacggtccgggaattgcgccggaacaacgtaagcacctgttccagccgtttgtccgcggcgacagtgcgcgcaccattagcggcacgggattagggctggcaattgtgcagcgtatcgtggataaccataacgggatgctggagcttggcaccagcgagcggggcgggctttccattcgcgcctggctgccagtgccggtaacgcgggcgcagggcacgacaaaagaaggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z