BBa_K191006 1 LovTAP LOVTAP 2009-10-15T11:00:00Z 2015-05-08T01:11:15Z Kindly provided by the authors of : Light-activated DNA binding in a designed allosteric protein; Strickland et al., Proceedings of the National Academy of Sciences (2008) vol. 105 (31) pp. 10709 Coding sequence of a fused protein (LOV means light, oxygen, and voltage,represent a light sensitive protein domain whereas TAP means tryptophan-activated protein). false false _287_ 0 4198 9 It's complicated true LOVTAP sequence contains 2 Pst1 restriction sites false Le Thanh Tu NGUYEN BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K191002 1 BBa_K191002 LovTAP - Term 2009-10-10T11:00:00Z 2015-05-08T01:11:15Z Kindly provided by the authors of : Light-activated DNA binding in a designed allosteric protein; Strickland et al., Proceedings of the National Academy of Sciences (2008) vol. 105 (31) pp. 10709 Coding sequence of a fused protein (LOV means light, oxygen, and voltage,represent a light sensitive protein domain whereas TAP means tryptophan-activated protein) followed by a terminator. false false _287_ 0 4198 9 It's complicated false LOVTap sequence contains 2 Pst1 restriction sites false Le Thanh Tu NGUYEN component2219505 1 BBa_B0015 component2219498 1 BBa_K191006 annotation2219505 1 BBa_B0015 range2219505 1 696 824 annotation2219498 1 BBa_K191006 range2219498 1 1 687 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K191002_sequence 1 atgttggctactacacttgaacgtattgagaagaactttgtcattactgacccaaggttgccagataatcccattatattcgcgtccgatagtttcttgcagttgacagaatatagccgtgaagaaattttgggaagaaactgcaggtttctacaaggtcctgaaactgatcgcgcgacagtgagaaaaattagagatgccatagataaccaaacagaggtcactgttcagctgattaattatacaaagagtggtaaaaagttctggaacctctttcacttgcagcctatgcgagatcagaagggagatgtccagtactttattggggttcagttggatggaactgagcatgtccgagatgctgccgagagagagggagtcatgctgattaagaaaactgcagaaaatattgatgaggcggcatttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattgtcgaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcgggcatcgcgacgattacgcgtggatctaacagcctgaaagccgcgcccgttgagctgcgccagtggctggaagaggtgttgctgaaaagcgattgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K191006_sequence 1 atgttggctactacacttgaacgtattgagaagaactttgtcattactgacccaaggttgccagataatcccattatattcgcgtccgatagtttcttgcagttgacagaatatagccgtgaagaaattttgggaagaaactgcaggtttctacaaggtcctgaaactgatcgcgcgacagtgagaaaaattagagatgccatagataaccaaacagaggtcactgttcagctgattaattatacaaagagtggtaaaaagttctggaacctctttcacttgcagcctatgcgagatcagaagggagatgtccagtactttattggggttcagttggatggaactgagcatgtccgagatgctgccgagagagagggagtcatgctgattaagaaaactgcagaaaatattgatgaggcggcatttgtcgacctgcttaagaatgcctaccaaaacgatctccatttaccgttgttaaacctgatgctgacgccagatgagcgcgaagcgttggggactcgcgtgcgtattgtcgaagagctgttgcgcggcgaaatgagccagcgtgagttaaaaaatgaactcggcgcgggcatcgcgacgattacgcgtggatctaacagcctgaaagccgcgcccgttgagctgcgccagtggctggaagaggtgttgctgaaaagcgattga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z