BBa_R0051 1 cI lam promoter (lambda cI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false true _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross annotation7067 1 BBa_R0051 range7067 1 1 49 annotation2024 1 OR1 range2024 1 25 41 annotation2023 1 -35 range2023 1 15 20 annotation2022 1 -10 range2022 1 38 43 annotation2025 1 OR2 range2025 1 1 17 BBa_B0033 1 BBa_B0033 RBS.4 (weaker) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weaker RBS based on Ron Weiss thesis. Strengths relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-3&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7028 1 BBa_B0033 range7028 1 1 11 annotation1713 1 RBS-4\Weaker range1713 1 1 11 annotation1714 1 RBS range1714 1 7 10 BBa_C0012 1 lacI lacI repressor from E. coli (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Coding region for the LacI protein with an LVA degradation tail and without an RBS. LacI binds to the pLac regulator <bb_part>BBa_R0010</bb_part> and PLlac01 hybrid regulator <bb_part>BBa_R0011</bb_part> and inhibits transcription. IPTG (Isopropylthiogalactoside) binds to LacI and inhibits its operation, therefore promoting transcription.</P> <P>A rapid degredation tail (LVA) has been added to improve the High to Low performance of this part.</P> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M.B., Leibler, S. A synthetic oscillatory network of transcriptional regulators. <em>Nature</em> 403, 335-338 (2000). <a href="http://biobricks.ai.mit.edu/BB_References.htm#ELOW00">[ELOW00]</a><br> <br> </P> <P> References (unparsed) here: <p>Elowitz, M.B., Leibler, S. A synthetic oscillatory network of transcriptional regulators. <em>Nature</em> 403, 335-338 (2000). <a href="http://biobricks.ai.mit.edu/BB_References.htm#ELOW00">[ELOW00]</a><br> <br> </P> <P>Sequence taken from the repressilator of Elowitz and Leibler (2000). The obtained sequence was compared to the wild-type sequence for LacI obtained through a database search. The sequence had been modified from the wild-type in that wild-type GTG start was changed to an ATG start (note, actual ORF in E.coli has several GTG starts it would seem). The LVA tag has been added for quicker degradation.<P> Incompatible with systems containing LacI, lactose, or IPTG. true Grace Kenney, Daniel Shen, Neelaksh Varshney, Samantha Sutton annotation7031 1 BBa_C0012 range7031 1 1 1128 annotation1723 1 lacI-LVA range1723 1 1 1128 annotation2213988 1 Help:Barcodes range2213988 1 1129 1153 annotation1722 1 LVA range1722 1 1090 1128 BBa_K1911000 1 BBa_K1911000 pLamdaR-LacI 2016-10-05T11:00:00Z 2016-10-14T06:11:56Z The part was created by combining multiple parts found on the iGEM parts registry. This part is a part of a larger construct which allows the system to change from one state to another. So when the E. coli cells containing the larger construct is induced with IPTG, the IPTG binds with the LacI repressor, allowing the other pathway to be expressed and it expresses a CI repressor which shuts down the 1st pathway. This part was created in order for teams to be able to easily place their genes of interest in this "switch" system. They would combine their gene of interest with the pLamdaR-LacI part and then proceed to combine it to the rest of the system. false false _2378_ 28764 28764 9 false We had to make sure there were no illegal restriction enzyme sites (EcoRI, PstI, SpeI, and XbaI) which cut the part in places where we did not want them to. false Jack Kwon component2486690 1 BBa_B0033 component2486693 1 BBa_C0012 component2486685 1 BBa_R0051 annotation2486690 1 BBa_B0033 range2486690 1 58 68 annotation2486685 1 BBa_R0051 range2486685 1 1 49 annotation2486693 1 BBa_C0012 range2486693 1 75 1202 BBa_K1911000_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgctactagagtcacacaggactactagatggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0033_sequence 1 tcacacaggac BBa_R0051_sequence 1 taacaccgtgcgtgttgactattttacctctggcggtgataatggttgc BBa_C0012_sequence 1 atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z