BBa_K1911002 1 BBa_K1911002 ClpP from E. coli 2016-10-05T11:00:00Z 2016-10-14T06:31:19Z ClpP is a naturally present gene in the E. coli genome. The ClpP sequence was pulled from the E. coli genome. The ClpP gene codes for the ClpP subunit protein which works together with the ClpX subunit to break down proteins that are tagged with degradation tags. The ClpXP system identifies tagged proteins and proceeds to unfold the protein and break it down into individual amino acids. The ClpXP system along with degradation tags can be used to break down certain proteins which are produced by certain genes of interest and it has a range of applications such as measuring how fast a certain protein can be degraded in a cell. false false _2378_ 28764 28764 9 false The sequence came from the E. coli genome so there were no design considerations to deal with while obtaining the ClpP sequence. false Jack Kwon BBa_K1911002_sequence 1 atgtcatacagcggcgaacgagataactttgcaccccatatggcgctggtgccgatggtcattgaacagacctcacgcggtgagcgctcttttgatatctattctcgtctacttaaggaacgcgtcatttttctgactggccaggttgaagaccacatggctaacctgattgtggcgcagatgctgttcctggaagcggaaaacccagaaaaagatatctatctgtacattaactccccaggcggggtgatcactgccgggatgtctatctatgacaccatgcagtttatcaagcctgatgtcagcaccatctgtatgggccaggcggcctcgatgggcgctttcttgctgaccgcaggggcaaaaggtaaacgtttttgcctgccaaattcgcgcgtgatgattcaccaaccgttgggcggctaccagggccaggcgaccgatatcgaaattcatgcccgtgaaattctgaaagttaaagggcgcatgaatgaacttatggcgcttcatacgggtcaatcattagaacagattgaacgtgataccgagcgcgatcgcttcctttccgcccctgaagcggtggaatacggtctggtcgattcgattctgacccatcgtaattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z