BBa_K1911005 1 BBa_K1911005 eGFP 2016-10-12T11:00:00Z 2016-10-14T06:32:00Z GFP is originally found in jellyfish Aequorea victoria but eGFP has been modified to be more sensitive. It helps the observers to easily determine the green coloration of the GFP protein. eGFP = Enhanced green fluorescent protein which can be used as a reporter gene. eGFP was used in our project to show the effects of attaching the DAS and LAA degradation tag to a target gene which is then degraded by the ClpXP system. In essence, the eGFP should be less prominent in E. coli cells which contain DAS tags and LAA tags compared to the E. coli cells that have constructs which do not have any degradation tags attached to the eGFP. eGFP can be used as a reporter gene and helps the observer easily see the coloration of E. coli cells which indicate a successful transformation. false false _2378_ 28764 28764 9 false The eGFP could not contain any illegal restriction enzyme sites as it would cut the sequence up, not allowing for the expression of the eGFP protein. false Jack Kwon BBa_K1911005_sequence 1 atggctagcaaaggagaagaactcttcactggagttgtcccaattcttgttgaattagatggtgatgttaacggccacaagttctctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttaccctgaagttcatctgcactactggcaaactgcctgttccatggccaaccctggtcactactctgtgctatggtgttcaatgcttttcaagatacccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaaggaccatcttcttcaaagatgacggcaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgacttcaaggaagatggcaacattctgggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagtgaacttcaagacccgccacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactgtacaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z