BBa_K1913019 1 BBa_K1913019 Guanine riboswitch BS-yxjA 2016-10-13T11:00:00Z 2016-10-14T07:37:54Z Genomic sequence of B. subtilis Guanine riboswitches BS-yxjA negatively modulate transcription upon guanine binding.BS-yxjA variant displays a higher 2AP affinity with an increase of 13-fold relative to other variants in vitro test. false false _2380_ 29979 29979 9 false According to Mulhbacher J et al, riboswitches BS-yxjA showed wide range sensitivity of Guanine concentration in vitro test. false Tianhe Wang annotation2505993 1 Anti-terminator range2505993 1 88 94 annotation2505994 1 terminator range2505994 1 129 189 annotation2505991 1 G box range2505991 1 1 81 annotation2506009 1 Anti-terminator range2506009 1 146 152 annotation2505992 1 Anti-terminator range2505992 1 80 86 annotation2506007 1 Anti-terminator range2506007 1 137 144 BBa_K1913019_sequence 1 aggaaaaagacattcttgtatatgatcagtaatatggtctgattgtttctacctagtaaccgtaaaaaactagactacaagaaagtttgaaaatttgaacgagttgaaaaggacaagttcttttctgtttgctcttatttttcacactttctgcacttccagaatttgtgaaggataagagcttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z