BBa_K1913022 1 BBa_K1913022 Synthetic plac-FixK2 hybrid promoter with RBS 2016-10-13T11:00:00Z 2016-10-19T03:38:55Z Genomic sequence of Bradyrhizobium japonicum. Synthetic plac-FixK2 hybrid promoter is the promoter that could not only be activated by light sensorsYF1-FixJ composite and but inhibited by LacI repressor. The sequence of upper control element is from wild type FixK2 hybrid promoter on genomic sequence of Bradyrhizobium japonicum, which contains two typical FixJ boxes. And core element region is replaced by constitutive promoter BBa_J23106. Addition lac operators on the both side of promoter as second control element that results in transcription repression. false false _2380_ 29556 29979 9 false according to some previous iGEM projects (UNITN-Trento 2013, INSA-Toulouse 2013), the transcription activity of the wild type Fixk2 promoter is so weak that they all added an inverter part to control their target gene expression. Even the original pDusk system in darkness has only 5 times expression levels than in light conditions. Therefore, we decided to enhance the transcriptional activity of the Fixk2 promoter by changing the core element region of the wild type Fixk2 by a strong constitutive promoter (BBa_J23106) from iGEM part registry and by adding two typical FixJ boxes into the -40 to -70 region. false Tianhe Wang annotation2502074 1 BBa_J23106 range2502074 1 89 123 annotation2502068 1 FixJ box range2502068 1 41 48 annotation2501918 1 conserved range2501918 1 5 8 annotation2502078 1 lac operator range2502078 1 1 21 annotation2502073 1 FixJ box range2502073 1 75 88 annotation2502076 1 lac operator range2502076 1 124 144 annotation2501919 1 BBa_B0034 range2501919 1 145 156 BBa_K1913022_sequence 1 ggcagtgagcgcaacgcaattccatccaggaccggcctcggtacgtagccggcctcgggcatgacctacggggtttgatctgggtcaatttacggctagctcagtcctaggtatagtgctagcaattgtgagcggataacaattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z