BBa_K1913023 1 BBa_K1913023 Synthetic plac-FixK2 hybrid promoter with RBS 2016-10-13T11:00:00Z 2016-10-19T03:45:19Z Genomic sequence of Bradyrhizobium japonicum. Synthetic plac-FixK2 hybrid promoter is the promoter that could not only be activated by light sensors YF1-FixJ composite and but inhibited by LacI repressor. The sequence of upper control element is from wild type FixK2 hybrid promoter on genomic sequence of Bradyrhizobium japonicum, which contains two typical FixJ boxes. And core element region is replaced by core element region of ompC promoter from another two-component systems EnvZ-OmpR in E. coli. Addition lac operators on the both side of promoter as second control element that results in transcription repression. false false _2380_ 29556 29979 9 false However, according to some previous iGEM projects (UNITN-Trento 2013, INSA-Toulouse 2013), the transcription activity of the wild type Fixk2 promoter is so weak that they all added an inverter part to control their target gene expression. Even the original pDusk system in darkness has only 5 times expression levels than in light conditions. Therefore, we decided to enhance the transcriptional activity of the Fixk2 promoter by changing the core element region of the wild type Fixk2 by switching core element region into ompC promoter -10 to -35 that from another two component system, because we couldn???t guarantee that FixJ boxes could be compatible with the core element of a constitutive promoter. false Tianhe Wang annotation2502555 1 lac operator range2502555 1 130 150 annotation2502208 1 FixJ box range2502208 1 41 48 annotation2502346 1 lac operator range2502346 1 1 21 annotation2502401 1 ompC core element range2502401 1 89 129 annotation2502128 1 BBa_B0034 range2502128 1 151 162 annotation2502168 1 FixJ box range2502168 1 75 88 annotation2502127 1 conserved range2502127 1 5 8 BBa_K1913023_sequence 1 ggcagtgagcgcaacgcaattccatccaggaccggcctcggtacgtagccggcctcgggcatgacctacggggtttgatctgggtcaaattcgtgttggattattctgcatttttggggagaatggactaattgtgagcggataacaattaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z