BBa_K1913024 1 BBa_K1913024 Synthetic ptet-FixK2 hybrid promoter with RBS 2016-10-13T11:00:00Z 2016-10-19T03:46:38Z genomic sequence of Bradyrhizobium japonicum Synthetic ptet-FixK2 hybrid promoter is the promoter that could not only be activated by light sensors YF1-FixJ composite and but inhibited by TetR repressor. The sequence of upper control element is from wild type FixK2 hybrid promoter on genomic sequence of Bradyrhizobium japonicum, which contains two typical FixJ boxes. And core element region is replaced by core element region of BBa_J23106. Addition tet operators are inserted into core element region of promoter as second control element that results in transcription repression. false false _2380_ 29556 29979 9 false According to some previous iGEM projects (UNITN-Trento 2013, INSA-Toulouse 2013), the transcription activity of the wild type Fixk2 promoter is so weak that they all added an inverter part to control their target gene expression. Even the original pDusk system in darkness has only 5 times expression levels than in light conditions. Therefore, we decided to enhance the transcriptional activity of the Fixk2 promoter by changing the core element region of the wild type Fixk2 by adding a strong constitutive promoter (BBa_J23106) from iGEM part registry and by adding two typical FixJ boxes into the -40 to -70 region. false Tianhe Wang annotation2502783 1 -10 range2502783 1 93 98 annotation2502785 1 -35 range2502785 1 68 73 annotation2502759 1 BBa_B0034 range2502759 1 124 135 annotation2502762 1 FixJ box range2502762 1 54 67 annotation2502781 1 tet operator range2502781 1 99 117 annotation2502761 1 FixJ box range2502761 1 20 27 annotation2502777 1 tet operator range2502777 1 74 92 annotation2502758 1 conserved range2502758 1 5 8 BBa_K1913024_sequence 1 ccatccaggaccggcctcggtacgtagccggcctcgggcatgacctacggggtttgatctgggtcaatttacgtccctatcagtgatagagatatagttccctatcagtgatagagagctagcaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z