BBa_K1913025 1 BBa_K1913025 Wild type plac-FixK2 hybrid promoter 2016-10-12T11:00:00Z 2016-10-14T03:31:57Z Genomic sequence of Bradyrhizobium japonicum Wild type plac-FixK2 hybrid promoter is the promoter that could not only be activated by light sensorsYF1-FixJ composite and but inhibited by LacI repressor. The sequence of upper control element and core element region are from wild type FixK2 hybrid promoter on genomic sequence of Bradyrhizobium japonicum. Addition lac operators on the both side of promoter as second control element that results in transcription repression. false false _2380_ 29979 29979 9 false In order to make Fixk2 promoter as an inducible promoter for the toggle switch,we had to add additional repressor operator sequences into the Fixk2 sequence, they are both on upstream and downstream the Fixk2 sequence, which could be bonded by tetrameric Lac repressor resulting in the formation of a DNA loop and consequently on transcription repression. false Tianhe Wang annotation2497357 1 -35 range2497357 1 98 98 annotation2497352 1 FixJ box range2497352 1 90 97 annotation2497351 1 FixJ box range2497351 1 64 67 annotation2497354 1 -10 range2497354 1 120 120 annotation2501595 1 RBS range2501595 1 153 157 annotation2497350 1 Lac operator range2497350 1 1 21 annotation2497353 1 Lac operator range2497353 1 132 152 BBa_K1913025_sequence 1 ggcagtgagcgcaacgcaattccatccaggaccggcctcgggcatgacctacggggttctacgtaaggcaccccccttaagatatcgctcgaaattttcgaacctcccgataccgcgtaccaatgcgtcataattgtgagcggataacaattggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z