BBa_K1913026 1 BBa_K1913026 Wild type ptet-FixK2 hybrid promoter 2016-10-13T11:00:00Z 2016-10-14T03:29:38Z Genomic sequence of Bradyrhizobium japonicum Wild type ptet-FixK2 hybrid promoter is the promoter that could not only be activated by light sensorsYF1-FixJ composite and but inhibited by TetR repressor. The sequence of upper control element and core element region are from wild type FixK2 hybrid promoter on genomic sequence of Bradyrhizobium japonicum. Additional tet operators are inserted in the core element region of promoter as second control element that results in transcription repression. false false _2380_ 29979 29979 9 false In order to make Fixk2 promoter as an inducible promoter for the toggle switch, we had to add additional repressor operator sequences into the Fixk2 sequence, they are both inserted in the core element region of the Fixk2 sequence, which could be bonded by dimerized TetR repressors resulting in the formation of steric hindrance and consequently on transcription repression. false Tianhe Wang annotation2501545 1 FixJ box range2501545 1 43 46 annotation2501547 1 FixJ box range2501547 1 69 76 annotation2501563 1 tet operator range2501563 1 107 125 annotation2501564 1 RBS range2501564 1 133 137 annotation2501548 1 tet operator range2501548 1 82 100 BBa_K1913026_sequence 1 ccatccaggaccggcctcgggcatgacctacggggttctacgtaaggcaccccccttaagatatcgctcgaaattttcgaatccctatcagtgatagagaaccaattccctatcagtgatagagagcgtctaggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z